Incidental Mutation 'R3906:Abcb7'
ID309211
Institutional Source Beutler Lab
Gene Symbol Abcb7
Ensembl Gene ENSMUSG00000031333
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 7
SynonymsAbc7
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3906 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location104280657-104413856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104284159 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 715 (Q715K)
Ref Sequence ENSEMBL: ENSMUSP00000033695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033695]
Predicted Effect probably benign
Transcript: ENSMUST00000033695
AA Change: Q715K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033695
Gene: ENSMUSG00000031333
AA Change: Q715K

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:ABC_membrane 140 424 5.6e-39 PFAM
AAA 497 683 1e-16 SMART
low complexity region 723 739 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a half-transporter involved in the transport of heme from the mitochondria to the cytosol. With iron/sulfur cluster precursors as its substrates, this protein may play a role in metal homeostasis. Mutations in this gene have been associated with mitochondrial iron accumulation and isodicentric (X)(q13) and sideroblastic anemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Hemizygous male and heterozygous female mice carrying a maternally inherited null allele display prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Abcb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Abcb7 APN X 104295978 missense possibly damaging 0.54
IGL03197:Abcb7 APN X 104284191 missense possibly damaging 0.74
R1851:Abcb7 UTSW X 104305399 missense probably benign 0.00
R1852:Abcb7 UTSW X 104305399 missense probably benign 0.00
R1892:Abcb7 UTSW X 104342536 missense probably damaging 1.00
R1893:Abcb7 UTSW X 104342536 missense probably damaging 1.00
R3908:Abcb7 UTSW X 104284159 missense probably benign
R4598:Abcb7 UTSW X 104323382 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGGTTCTACTTCAGTGCAAATGC -3'
(R):5'- ACAGGTCCTCCAAATAGTTCCTC -3'

Sequencing Primer
(F):5'- CTTCAGTGCAAATGCTAATGCC -3'
(R):5'- AGGTAGCTGAACGTGGTA -3'
Posted On2015-04-17