Incidental Mutation 'R3906:Hspa1a'
ID309208
Institutional Source Beutler Lab
Gene Symbol Hspa1a
Ensembl Gene ENSMUSG00000091971
Gene Nameheat shock protein 1A
SynonymsHsp70.3, Hsp70-3
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3906 (G1)
Quality Score191
Status Validated
Chromosome17
Chromosomal Location34969190-34972156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34971727 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 67 (V67M)
Ref Sequence ENSEMBL: ENSMUSP00000084586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000087328] [ENSMUST00000173680]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087328
AA Change: V67M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084586
Gene: ENSMUSG00000091971
AA Change: V67M

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173680
SMART Domains Protein: ENSMUSP00000133726
Gene: ENSMUSG00000092609

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
internal_repeat_1 91 102 5.9e-5 PROSPERO
internal_repeat_1 113 124 5.9e-5 PROSPERO
low complexity region 134 146 N/A INTRINSIC
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: At the cellular level, mice homozygous for a knock-out allele exhibit impaired thermotolerance and increased sensitivity to heat stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Hspa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Hspa1a APN 17 34970524 missense probably damaging 1.00
IGL03380:Hspa1a APN 17 34970277 missense probably benign 0.17
R1983:Hspa1a UTSW 17 34970962 missense probably benign 0.01
R2117:Hspa1a UTSW 17 34970479 missense probably damaging 1.00
R3825:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3905:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3908:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3909:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R4301:Hspa1a UTSW 17 34970506 missense probably benign 0.11
R4453:Hspa1a UTSW 17 34970293 missense probably benign 0.32
R4610:Hspa1a UTSW 17 34971180 missense probably damaging 0.96
R4904:Hspa1a UTSW 17 34970451 missense probably damaging 1.00
R6253:Hspa1a UTSW 17 34970550 missense probably damaging 1.00
R6366:Hspa1a UTSW 17 34970524 missense probably damaging 1.00
R6478:Hspa1a UTSW 17 34970306 missense probably damaging 1.00
R6981:Hspa1a UTSW 17 34970291 splice site probably null
R8015:Hspa1a UTSW 17 34970649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATGGACGAGATCTC -3'
(R):5'- GTTCCATCCAGAGACAAGCG -3'

Sequencing Primer
(F):5'- GAGATCTCCTCCGGGAAGAAC -3'
(R):5'- TTCCAGAAGCAGAGCGC -3'
Posted On2015-04-17