Incidental Mutation 'R3906:Cacng1'
ID309193
Institutional Source Beutler Lab
Gene Symbol Cacng1
Ensembl Gene ENSMUSG00000020722
Gene Namecalcium channel, voltage-dependent, gamma subunit 1
Synonyms
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107703218-107716522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107716292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 34 (V34L)
Ref Sequence ENSEMBL: ENSMUSP00000021065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021065]
Predicted Effect probably benign
Transcript: ENSMUST00000021065
AA Change: V34L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021065
Gene: ENSMUSG00000020722
AA Change: V34L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 200 6.3e-12 PFAM
Pfam:Claudin_2 17 202 2.6e-41 PFAM
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for null mutations display abnormal muscle calcium currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Cacng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Cacng1 APN 11 107704369 missense probably benign
IGL02623:Cacng1 APN 11 107704319 missense probably damaging 1.00
R0920:Cacng1 UTSW 11 107705856 splice site probably benign
R2042:Cacng1 UTSW 11 107704308 missense probably damaging 1.00
R3908:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3909:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R5247:Cacng1 UTSW 11 107716279 missense probably benign 0.45
R7158:Cacng1 UTSW 11 107703839 missense probably damaging 0.99
R7473:Cacng1 UTSW 11 107716192 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGTACCTCAGGCTGTTTCC -3'
(R):5'- TGCCACCATCTAGCTAGCTG -3'

Sequencing Primer
(F):5'- CTTATCTTGGAGTCTTGAAAGGAC -3'
(R):5'- ATCTAGCTAGCTGCCTGGGAG -3'
Posted On2015-04-17