Mutagenetix > Incidental Mutations

Incidental Mutation 'R4009:Atp8a2'

311618

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

040846-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.415) question?

Stock #

R4009 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60027985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 301 (S301P)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368] [ENSMUST00000145071]

AlphaFold

P98200

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080368
AA Change: S301P

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: S301P

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145071

SMART Domains

Protein: ENSMUSP00000115592
Gene: ENSMUSG00000021983

Domain	Start	End	E-Value	Type
SCOP:d1eula_	21	129	1e-6	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,090,107	L35Q	probably damaging	Het
Acss2	T	A	2: 155,557,628	L529Q	probably damaging	Het
Apc2	T	A	10: 80,313,592	D1464E	probably benign	Het
Cntln	A	G	4: 85,063,215	T877A	probably benign	Het
Cntn6	T	C	6: 104,833,822	I537T	probably damaging	Het
Cyp2d12	T	G	15: 82,556,292	L94R	probably damaging	Het
Dnah7a	A	G	1: 53,525,005	L1965P	probably damaging	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
F830045P16Rik	A	T	2: 129,463,547	N302K	probably damaging	Het
Fxr1	G	T	3: 34,065,022	R580L	probably benign	Het
Gm5592	G	T	7: 41,289,510	V739L	probably benign	Het
Gna13	A	G	11: 109,396,017	D222G	probably damaging	Het
Grm7	T	A	6: 111,495,722	Y841N	probably damaging	Het
Kat2b	G	A	17: 53,644,741		probably null	Het
Kcng4	A	G	8: 119,626,085	V362A	probably damaging	Het
Kcnh1	T	A	1: 192,277,140	I334N	probably benign	Het
Mapkbp1	T	C	2: 120,023,605	S1222P	probably benign	Het
Olfr1122	A	T	2: 87,388,580	I292F	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr512	A	T	7: 108,714,159	I269L	probably benign	Het
Olfr742	T	C	14: 50,515,962	S253P	possibly damaging	Het
Pik3cb	A	G	9: 99,040,929	Y1017H	probably damaging	Het
Plpp5	A	G	8: 25,720,311	E36G	probably damaging	Het
Pnmal1	A	T	7: 16,961,376	K385N	probably damaging	Het
Ptprd	T	G	4: 75,956,397	M1272L	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,051	I325V	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skint4	T	C	4: 112,120,109	V232A	possibly damaging	Het
Slc30a5	G	A	13: 100,809,233	A537V	probably damaging	Het
Tcerg1	CAATTGAAAA	CAA	18: 42,564,136		probably null	Het
Tenm3	C	A	8: 48,349,223	K162N	probably damaging	Het
Vmn2r44	T	A	7: 8,377,988	Q302L	possibly damaging	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59654626	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	59860212	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	59773966	missense	probably damaging	1.00
R3896:Atp8a2	UTSW	14	60026140	critical splice donor site	probably null
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6393:Atp8a2	UTSW	14	59773755	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60017840	splice site	probably null
R7243:Atp8a2	UTSW	14	59647842	missense	probably benign
R7352:Atp8a2	UTSW	14	59791204	missense	probably benign
R7355:Atp8a2	UTSW	14	60045004	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59654594	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	59791181	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60008375	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	59857067	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
R8116:Atp8a2	UTSW	14	60026208	missense	probably damaging	1.00
R8171:Atp8a2	UTSW	14	60046044	missense	probably damaging	1.00
R8504:Atp8a2	UTSW	14	59647917	nonsense	probably null
R8516:Atp8a2	UTSW	14	59691472	missense	probably benign	0.00
R8552:Atp8a2	UTSW	14	59773982	missense	probably benign	0.00
R8852:Atp8a2	UTSW	14	59925096	missense	probably damaging	1.00
R9367:Atp8a2	UTSW	14	60012378	critical splice donor site	probably null
R9469:Atp8a2	UTSW	14	59791219	missense	probably benign	0.32
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign
Z1177:Atp8a2	UTSW	14	60006330	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATACACCCATCTTCAGTCTACATG -3'
(R):5'- ACATCTAGCCTGTTCTGTGGTG -3'

Sequencing Primer
(F):5'- TTTCTCTACCAGAAAGCCGGG -3'
(R):5'- GGTTACTGACTTTCAATACTGGTTC -3'

Posted On

2015-04-29