Incidental Mutation 'R1426:Atp8a2'
ID162260
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R1426 (G1)
Quality Score98
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59860270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 770 (K770E)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably benign
Transcript: ENSMUST00000080368
AA Change: K770E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: K770E

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 intron probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGATGGTGGCTTCCCAAGGTAGG -3'
(R):5'- ATCCCACACAGCAGTGGATAGCAG -3'

Sequencing Primer
(F):5'- TTCCCAAGGTAGGCAGAGTC -3'
(R):5'- GTGTCCATGAACTTAGCGAAC -3'
Posted On2014-03-14