Incidental Mutation 'R7831:Atp8a2'
ID605658
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R7831 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59773753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 968 (V968D)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably damaging
Transcript: ENSMUST00000080368
AA Change: V968D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: V968D

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,297,404 V2384I possibly damaging Het
Acsl1 A G 8: 46,519,006 D297G probably benign Het
Ap2a1 C A 7: 44,901,012 R944L probably damaging Het
Apbb1ip A G 2: 22,866,921 Y398C probably damaging Het
Becn1 T C 11: 101,290,453 T341A probably benign Het
Card11 G T 5: 140,873,412 S1126R possibly damaging Het
Ccdc51 T C 9: 109,091,990 L315S probably damaging Het
Cdk12 T C 11: 98,249,827 L1298P unknown Het
Cep170b A T 12: 112,744,800 D1538V probably benign Het
Cfap52 A T 11: 67,935,956 F348I possibly damaging Het
Clip1 A T 5: 123,613,279 M813K Het
Col19a1 G A 1: 24,526,482 T256I unknown Het
Col6a3 A T 1: 90,796,546 C2027* probably null Het
Crisp4 A T 1: 18,128,789 N140K probably benign Het
Crocc2 G T 1: 93,215,473 A1266S probably benign Het
Cyfip2 G A 11: 46,196,446 R1206C probably damaging Het
Cyp24a1 T A 2: 170,485,940 M461L probably damaging Het
Cyp2a5 C T 7: 26,835,515 T51I possibly damaging Het
Cyp2b19 C T 7: 26,767,140 H398Y possibly damaging Het
Cyp4a29 G A 4: 115,250,170 V234I probably benign Het
Dicer1 T G 12: 104,708,800 K734N probably damaging Het
Dnaic1 T C 4: 41,614,695 probably null Het
Entpd3 G A 9: 120,543,959 G14D probably damaging Het
Ermp1 T C 19: 29,617,967 T634A probably benign Het
Evc C T 5: 37,319,083 G374D probably damaging Het
Fam189b G A 3: 89,184,213 probably null Het
Fcgbp C A 7: 28,106,979 T2124K probably damaging Het
Fgf8 G A 19: 45,742,437 P50S probably benign Het
Fmnl1 C T 11: 103,198,173 R1074W unknown Het
Galnt18 C T 7: 111,556,458 V223M possibly damaging Het
Galnt2 A G 8: 124,332,078 N295S probably benign Het
Gm9573 T A 17: 35,618,759 T1512S unknown Het
Grip1 T G 10: 120,018,106 V600G probably damaging Het
Insm2 T A 12: 55,600,538 C356S probably damaging Het
Itpr2 T A 6: 146,291,584 I1672F probably benign Het
Kdm1b T G 13: 47,050,622 N76K probably benign Het
Khnyn T A 14: 55,887,846 probably null Het
Kidins220 C T 12: 25,061,231 A1167V possibly damaging Het
Krt40 T C 11: 99,541,261 D208G probably benign Het
Lars T A 18: 42,217,562 D894V probably benign Het
Lmx1a A T 1: 167,840,952 N266I probably benign Het
Mrgprb5 T A 7: 48,168,249 K246M probably benign Het
Mrpl2 G A 17: 46,648,672 G176R possibly damaging Het
Nell1 T A 7: 49,982,800 F60L possibly damaging Het
Nnt G A 13: 119,370,094 A453V possibly damaging Het
Olfr366 C T 2: 37,219,711 T74I probably damaging Het
Olfr398 A C 11: 73,984,431 M59R probably damaging Het
Olfr697 T A 7: 106,741,413 I174F probably damaging Het
Opa1 A G 16: 29,648,937 K940R probably benign Het
Opn5 A C 17: 42,580,619 I309S probably null Het
P3h3 T G 6: 124,855,155 E256A possibly damaging Het
Pald1 G T 10: 61,355,814 T65K probably damaging Het
Pcnx3 T C 19: 5,685,961 Y279C probably damaging Het
Pik3c2b G A 1: 133,071,242 S367N possibly damaging Het
Pik3cb T C 9: 99,088,613 T342A probably benign Het
Pkd1l3 A T 8: 109,631,358 E837D possibly damaging Het
Ppp2r2b T A 18: 42,701,532 Y191F probably benign Het
Ppp4r4 G A 12: 103,590,821 E439K possibly damaging Het
Pqlc3 T A 12: 16,997,631 probably null Het
Ptprk A G 10: 28,568,408 I946V possibly damaging Het
Ror1 A G 4: 100,441,098 N556S probably benign Het
Ryr3 C T 2: 112,926,838 A391T possibly damaging Het
Selp G A 1: 164,145,015 probably null Het
Setx T C 2: 29,157,108 L1866S probably damaging Het
Setx T A 2: 29,179,854 V2557E possibly damaging Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Sorbs3 T G 14: 70,203,032 N89T possibly damaging Het
Sorl1 C A 9: 42,089,961 V248L probably benign Het
Srebf2 T A 15: 82,182,087 V612E probably damaging Het
Sv2c T A 13: 95,976,692 Y583F probably damaging Het
Tada1 G T 1: 166,389,873 R193I probably damaging Het
Tnrc6b C G 15: 80,880,379 A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn C T 2: 76,881,081 G8372D unknown Het
Ube2g2 A G 10: 77,634,742 T68A Het
Ubl7 T G 9: 57,914,635 V89G possibly damaging Het
Ush2a T A 1: 188,759,841 I3109N probably damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r26 T A 6: 124,039,799 Y407* probably null Het
Yod1 G T 1: 130,719,249 V288F probably damaging Het
Zbed5 A C 5: 129,901,957 N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 T47A probably damaging Het
Zcchc14 T C 8: 121,605,245 T460A not run Het
Zfp712 A C 13: 67,052,419 probably null Het
Zfyve16 A T 13: 92,522,328 H358Q probably benign Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 splice site probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R8116:Atp8a2 UTSW 14 60026208 missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60046044 missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59647917 nonsense probably null
R8516:Atp8a2 UTSW 14 59691472 missense probably benign 0.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAGTAGGTGAGACTGAATCCC -3'
(R):5'- CACACGTGGATTATACCTCCC -3'

Sequencing Primer
(F):5'- GTGAGACTGAATCCCAAATTGGCC -3'
(R):5'- GTGGATTATACCTCCCTAGATATGC -3'
Posted On2019-12-20