Incidental Mutation 'R4029:Ly6g6d'
ID313141
Institutional Source Beutler Lab
Gene Symbol Ly6g6d
Ensembl Gene ENSMUSG00000073413
Gene Namelymphocyte antigen 6 complex, locus G6D
SynonymsNG25, MEGT1, G6d, G6f, NG32, A930024F17Rik
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35071443-35078065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35071660 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 98 (Q98L)
Ref Sequence ENSEMBL: ENSMUSP00000007259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007259] [ENSMUST00000173207] [ENSMUST00000173478] [ENSMUST00000174876]
Predicted Effect probably benign
Transcript: ENSMUST00000007259
AA Change: Q98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000007259
Gene: ENSMUSG00000073413
AA Change: Q98L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173120
Predicted Effect probably benign
Transcript: ENSMUST00000173207
SMART Domains Protein: ENSMUSP00000134194
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Blast:LU 48 136 3e-57 BLAST
low complexity region 139 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173478
SMART Domains Protein: ENSMUSP00000133510
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LU 22 110 2e-57 BLAST
low complexity region 113 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174876
SMART Domains Protein: ENSMUSP00000133838
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LU 22 56 9e-18 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]).[supplied by OMIM, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Ly6g6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Ly6g6d APN 17 35074250 missense probably benign 0.04
R0668:Ly6g6d UTSW 17 35071739 missense probably damaging 0.98
R1278:Ly6g6d UTSW 17 35071660 missense probably benign 0.00
R1891:Ly6g6d UTSW 17 35074293 nonsense probably null
R4960:Ly6g6d UTSW 17 35071754 missense probably benign 0.01
R5125:Ly6g6d UTSW 17 35074442 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTTAACGGCACACAAGGGAG -3'
(R):5'- AGCCCCTAGACTTTGTAACTGC -3'

Sequencing Primer
(F):5'- CACAAGGGAGTGTTTGTCTTCTTACC -3'
(R):5'- GTAACTGCTCTCTCTCAGGGAAG -3'
Posted On2015-04-30