Incidental Mutation 'R4029:Nck2'
ID 313114
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Name non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms 4833426I10Rik, Grb4, NCKbeta
MMRRC Submission 040959-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4029 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 43444579-43570515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43554091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 153 (F153L)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000202540]
AlphaFold O55033
Predicted Effect probably benign
Transcript: ENSMUST00000086421
AA Change: F153L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: F153L

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114744
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202540
SMART Domains Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 4.3e-19 SMART
PDB:2CUB|A 106 142 4e-13 PDB
Blast:SH3 114 142 3e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
wake UTSW 1 43554260 missense probably benign
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R1080:Nck2 UTSW 1 43533581 missense probably benign 0.00
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6683:Nck2 UTSW 1 43569178 missense probably benign
R6859:Nck2 UTSW 1 43554351 missense probably benign 0.24
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
R8278:Nck2 UTSW 1 43554580 missense probably damaging 1.00
R9004:Nck2 UTSW 1 43554350 missense
R9063:Nck2 UTSW 1 43554343 missense possibly damaging 0.91
R9559:Nck2 UTSW 1 43554047 missense probably damaging 1.00
R9746:Nck2 UTSW 1 43533732 nonsense probably null
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTTCACAGGCCTCGGAAAG -3'
(R):5'- GAAACTAAGCTCCTCCTCAGTGAC -3'

Sequencing Primer
(F):5'- AAGCGCTCGGGATGCTTC -3'
(R):5'- TCCTCAGTGACCGAGCTGAAG -3'
Posted On 2015-04-30