Incidental Mutation 'R4119:Zfp472'
ID315246
Institutional Source Beutler Lab
Gene Symbol Zfp472
Ensembl Gene ENSMUSG00000053600
Gene Namezinc finger protein 472
SynonymsKrim-1, Krim-1A, Krim-1B
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32965814-32979233 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32978215 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 421 (Y421*)
Ref Sequence ENSEMBL: ENSMUSP00000036514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039132]
Predicted Effect probably null
Transcript: ENSMUST00000039132
AA Change: Y421*
SMART Domains Protein: ENSMUSP00000036514
Gene: ENSMUSG00000053600
AA Change: Y421*

DomainStartEndE-ValueType
KRAB 10 62 4.36e-15 SMART
ZnF_C2H2 197 219 2.45e0 SMART
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.76e-1 SMART
ZnF_C2H2 281 303 3.58e-2 SMART
ZnF_C2H2 309 331 3.29e-1 SMART
ZnF_C2H2 337 359 6.08e0 SMART
ZnF_C2H2 365 387 2.32e-1 SMART
ZnF_C2H2 393 415 6.57e-1 SMART
ZnF_C2H2 421 443 1.5e-4 SMART
ZnF_C2H2 449 471 2.2e-2 SMART
ZnF_C2H2 477 499 1.01e-1 SMART
ZnF_C2H2 505 527 8.94e-3 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Zfp472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp472 APN 17 32977524 missense possibly damaging 0.47
IGL03012:Zfp472 APN 17 32977571 missense probably benign 0.18
IGL03184:Zfp472 APN 17 32977416 nonsense probably null
IGL03223:Zfp472 APN 17 32977274 missense probably benign 0.03
R0421:Zfp472 UTSW 17 32975923 missense possibly damaging 0.71
R0463:Zfp472 UTSW 17 32975962 missense probably damaging 0.98
R0614:Zfp472 UTSW 17 32977934 missense possibly damaging 0.53
R1348:Zfp472 UTSW 17 32977820 missense probably benign 0.44
R1557:Zfp472 UTSW 17 32975926 missense probably benign 0.32
R1630:Zfp472 UTSW 17 32977978 nonsense probably null
R1725:Zfp472 UTSW 17 32977337 missense possibly damaging 0.53
R1856:Zfp472 UTSW 17 32965913 missense possibly damaging 0.53
R1964:Zfp472 UTSW 17 32977874 missense possibly damaging 0.79
R2115:Zfp472 UTSW 17 32978014 missense possibly damaging 0.73
R2249:Zfp472 UTSW 17 32978135 missense possibly damaging 0.87
R2252:Zfp472 UTSW 17 32976283 nonsense probably null
R3709:Zfp472 UTSW 17 32977711 nonsense probably null
R4406:Zfp472 UTSW 17 32978160 missense probably benign 0.01
R4485:Zfp472 UTSW 17 32977568 missense possibly damaging 0.96
R4650:Zfp472 UTSW 17 32977657 missense possibly damaging 0.86
R4820:Zfp472 UTSW 17 32977442 missense probably benign 0.01
R5369:Zfp472 UTSW 17 32977743 missense probably damaging 0.98
R5438:Zfp472 UTSW 17 32978219 missense probably damaging 0.96
R5529:Zfp472 UTSW 17 32978433 missense possibly damaging 0.92
R5950:Zfp472 UTSW 17 32977507 missense possibly damaging 0.53
R6158:Zfp472 UTSW 17 32978389 nonsense probably null
R7012:Zfp472 UTSW 17 32977246 missense probably benign 0.00
R8108:Zfp472 UTSW 17 32978003 missense possibly damaging 0.86
R8290:Zfp472 UTSW 17 32978114 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCTGCTATTATCACGAAAG -3'
(R):5'- AGTGCGAGAAATATTAGCCACTG -3'

Sequencing Primer
(F):5'- TTCACACTGGAGAGAAGCCCTG -3'
(R):5'- TGGAACAGGTGAACGCTTTCC -3'
Posted On2015-05-14