Incidental Mutation 'R0614:Zfp472'
ID 54978
Institutional Source Beutler Lab
Gene Symbol Zfp472
Ensembl Gene ENSMUSG00000053600
Gene Name zinc finger protein 472
Synonyms Krim-1, Krim-1A, Krim-1B
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0614 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32965814-32979233 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32977934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 328 (E328K)
Ref Sequence ENSEMBL: ENSMUSP00000036514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039132]
AlphaFold B0V2W5
Predicted Effect possibly damaging
Transcript: ENSMUST00000039132
AA Change: E328K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036514
Gene: ENSMUSG00000053600
AA Change: E328K

KRAB 10 62 4.36e-15 SMART
ZnF_C2H2 197 219 2.45e0 SMART
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.76e-1 SMART
ZnF_C2H2 281 303 3.58e-2 SMART
ZnF_C2H2 309 331 3.29e-1 SMART
ZnF_C2H2 337 359 6.08e0 SMART
ZnF_C2H2 365 387 2.32e-1 SMART
ZnF_C2H2 393 415 6.57e-1 SMART
ZnF_C2H2 421 443 1.5e-4 SMART
ZnF_C2H2 449 471 2.2e-2 SMART
ZnF_C2H2 477 499 1.01e-1 SMART
ZnF_C2H2 505 527 8.94e-3 SMART
Meta Mutation Damage Score 0.2438 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Zfp472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp472 APN 17 32977524 missense possibly damaging 0.47
IGL03012:Zfp472 APN 17 32977571 missense probably benign 0.18
IGL03184:Zfp472 APN 17 32977416 nonsense probably null
IGL03223:Zfp472 APN 17 32977274 missense probably benign 0.03
R0421:Zfp472 UTSW 17 32975923 missense possibly damaging 0.71
R0463:Zfp472 UTSW 17 32975962 missense probably damaging 0.98
R1348:Zfp472 UTSW 17 32977820 missense probably benign 0.44
R1557:Zfp472 UTSW 17 32975926 missense probably benign 0.32
R1630:Zfp472 UTSW 17 32977978 nonsense probably null
R1725:Zfp472 UTSW 17 32977337 missense possibly damaging 0.53
R1856:Zfp472 UTSW 17 32965913 missense possibly damaging 0.53
R1964:Zfp472 UTSW 17 32977874 missense possibly damaging 0.79
R2115:Zfp472 UTSW 17 32978014 missense possibly damaging 0.73
R2249:Zfp472 UTSW 17 32978135 missense possibly damaging 0.87
R2252:Zfp472 UTSW 17 32976283 nonsense probably null
R3709:Zfp472 UTSW 17 32977711 nonsense probably null
R4119:Zfp472 UTSW 17 32978215 nonsense probably null
R4406:Zfp472 UTSW 17 32978160 missense probably benign 0.01
R4485:Zfp472 UTSW 17 32977568 missense possibly damaging 0.96
R4650:Zfp472 UTSW 17 32977657 missense possibly damaging 0.86
R4820:Zfp472 UTSW 17 32977442 missense probably benign 0.01
R5369:Zfp472 UTSW 17 32977743 missense probably damaging 0.98
R5438:Zfp472 UTSW 17 32978219 missense probably damaging 0.96
R5529:Zfp472 UTSW 17 32978433 missense possibly damaging 0.92
R5950:Zfp472 UTSW 17 32977507 missense possibly damaging 0.53
R6158:Zfp472 UTSW 17 32978389 nonsense probably null
R7012:Zfp472 UTSW 17 32977246 missense probably benign 0.00
R8108:Zfp472 UTSW 17 32978003 missense possibly damaging 0.86
R8290:Zfp472 UTSW 17 32978114 missense probably benign
R8905:Zfp472 UTSW 17 32978481 missense possibly damaging 0.82
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctttcccacactgcttacatac -3'
Posted On 2013-07-11