Incidental Mutation 'R4119:Nbeal1'
ID 315206
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 040992-MU
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4119 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 60180599-60338328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60291870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 2213 (I2213L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000162291]
AlphaFold E9PYP2
Predicted Effect
SMART Domains Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: I946L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
Pfam:DUF4704 851 1130 3.4e-39 PFAM
low complexity region 1383 1401 N/A INTRINSIC
Pfam:DUF4800 1575 1828 6.3e-126 PFAM
coiled coil region 1859 1882 N/A INTRINSIC
Pfam:PH_BEACH 1889 1975 2e-24 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124850
Gene: ENSMUSG00000073664
AA Change: I226L

DomainStartEndE-ValueType
Beach 31 246 4.21e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: I2213L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: I2213L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162291
SMART Domains Protein: ENSMUSP00000125592
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 114 132 N/A INTRINSIC
low complexity region 580 596 N/A INTRINSIC
Pfam:PH_BEACH 613 706 9.6e-33 PFAM
Meta Mutation Damage Score 0.4263 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
coach UTSW 1 60253481 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 splice site probably null
horrified UTSW 1 60244824 missense probably damaging 1.00
Lampoon UTSW 1 60261586 critical splice donor site probably null
lawyer UTSW 1 60310224 nonsense probably null
magistrate UTSW 1 60194597 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60194599 splice site probably benign
satirical UTSW 1 60235562 critical splice donor site probably null
silky UTSW 1 60330878 splice site probably benign
stiggs UTSW 1 60237151 missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 splice site probably null
R4798:Nbeal1 UTSW 1 60222193 splice site probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60310224 nonsense probably null
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60217196 missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60244810 missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60194597 critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60261584 missense probably benign
R7507:Nbeal1 UTSW 1 60235467 missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60277227 missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60244824 missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60257450 missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60319341 missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60291889 missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60260432 missense probably benign
R7902:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60260272 nonsense probably null
R8053:Nbeal1 UTSW 1 60279795 missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60200133 missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60253481 nonsense probably null
R8209:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60235562 critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60235157 missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60268383 missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60235211 missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60261584 missense probably benign
R8952:Nbeal1 UTSW 1 60260300 missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60289959 missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60278726 missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60268389 missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60247745 nonsense probably null
R9168:Nbeal1 UTSW 1 60291888 missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60281266 missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60278680 missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60268389 missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60258659 missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60310265 missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60251128 nonsense probably null
R9557:Nbeal1 UTSW 1 60235350 missense probably benign
R9560:Nbeal1 UTSW 1 60329385 missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60311088 missense probably damaging 1.00
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTTCATTCACCAAGCAG -3'
(R):5'- CAGTTTTGTGACCTCCAACTG -3'

Sequencing Primer
(F):5'- TGCTGGACATCGAACATGC -3'
(R):5'- CAGTTTTGTGACCTCCAACTGAAAAG -3'
Posted On 2015-05-14