Incidental Mutation 'R4119:Vmn2r39'
ID315228
Institutional Source Beutler Lab
Gene Symbol Vmn2r39
Ensembl Gene ENSMUSG00000096658
Gene Namevomeronasal 2, receptor 39
SynonymsEG545909
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location9013875-9030798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9023674 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 443 (H443Y)
Ref Sequence ENSEMBL: ENSMUSP00000134010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174388]
Predicted Effect probably benign
Transcript: ENSMUST00000174388
AA Change: H443Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000134010
Gene: ENSMUSG00000096658
AA Change: H443Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 9.1e-32 PFAM
Pfam:NCD3G 512 565 7.9e-21 PFAM
Pfam:7tm_3 598 833 2.6e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Vmn2r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Vmn2r39 APN 7 9023644 missense probably benign 0.19
IGL03017:Vmn2r39 APN 7 9014941 missense probably damaging 1.00
R1314:Vmn2r39 UTSW 7 9014982 missense probably damaging 1.00
R1358:Vmn2r39 UTSW 7 9023688 missense possibly damaging 0.63
R1480:Vmn2r39 UTSW 7 9014956 missense probably damaging 1.00
R4120:Vmn2r39 UTSW 7 9023674 missense probably benign 0.01
R4720:Vmn2r39 UTSW 7 9023470 critical splice donor site probably null
R4990:Vmn2r39 UTSW 7 9023676 missense probably benign
R5079:Vmn2r39 UTSW 7 9023490 missense probably benign 0.05
R5695:Vmn2r39 UTSW 7 9025151 missense possibly damaging 0.87
R6131:Vmn2r39 UTSW 7 9014964 missense probably damaging 1.00
R6561:Vmn2r39 UTSW 7 9015093 missense probably damaging 1.00
R7108:Vmn2r39 UTSW 7 9023668 missense probably damaging 0.96
R7122:Vmn2r39 UTSW 7 9014762 missense possibly damaging 0.72
R8793:Vmn2r39 UTSW 7 9025150 missense probably damaging 1.00
Z1176:Vmn2r39 UTSW 7 9015033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACCTCAAGCATGTCTAC -3'
(R):5'- GAGCCTCTCTCAGTGTTAATGTGTATG -3'

Sequencing Primer
(F):5'- CCTCAAGCATGTCTACATATAAGTG -3'
(R):5'- TTGGTATTCTTCACTGAGAGAATTG -3'
Posted On2015-05-14