Incidental Mutation 'R4119:Usp29'
ID315227
Institutional Source Beutler Lab
Gene Symbol Usp29
Ensembl Gene ENSMUSG00000051527
Gene Nameubiquitin specific peptidase 29
SynonymsOcat
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6730578-6967219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6962806 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 549 (N549K)
Ref Sequence ENSEMBL: ENSMUSP00000143769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054055] [ENSMUST00000197117] [ENSMUST00000198068] [ENSMUST00000200535]
Predicted Effect probably benign
Transcript: ENSMUST00000054055
AA Change: N549K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062349
Gene: ENSMUSG00000051527
AA Change: N549K

DomainStartEndE-ValueType
Pfam:UCH_N 1 107 6.1e-37 PFAM
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:UCH 288 823 6.1e-53 PFAM
Pfam:UCH_1 289 615 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197117
SMART Domains Protein: ENSMUSP00000143283
Gene: ENSMUSG00000051527

DomainStartEndE-ValueType
PDB:3U12|B 11 73 3e-7 PDB
low complexity region 82 95 N/A INTRINSIC
low complexity region 169 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198068
AA Change: N549K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143267
Gene: ENSMUSG00000051527
AA Change: N549K

DomainStartEndE-ValueType
PDB:3U12|B 11 123 3e-6 PDB
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 7.9e-52 PFAM
Pfam:UCH_1 296 626 9.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200535
AA Change: N549K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143769
Gene: ENSMUSG00000051527
AA Change: N549K

DomainStartEndE-ValueType
Pfam:UCH_N 8 114 8.3e-34 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 2.8e-51 PFAM
Pfam:UCH_1 296 622 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204486
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Usp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Usp29 APN 7 6962282 missense probably benign 0.06
IGL01588:Usp29 APN 7 6962611 missense probably benign 0.33
IGL02032:Usp29 APN 7 6962018 missense probably benign 0.41
IGL02052:Usp29 APN 7 6962526 missense probably benign 0.06
IGL02331:Usp29 APN 7 6962156 missense probably benign 0.16
IGL02551:Usp29 APN 7 6963353 splice site probably null
IGL02573:Usp29 APN 7 6962618 splice site probably null
IGL02894:Usp29 APN 7 6961634 missense probably benign 0.00
R0029:Usp29 UTSW 7 6961581 missense probably damaging 0.99
R0142:Usp29 UTSW 7 6962335 missense probably benign 0.12
R0452:Usp29 UTSW 7 6963182 missense possibly damaging 0.82
R0680:Usp29 UTSW 7 6962885 missense possibly damaging 0.92
R1161:Usp29 UTSW 7 6961530 missense probably damaging 1.00
R2391:Usp29 UTSW 7 6963771 splice site probably null
R3104:Usp29 UTSW 7 6962053 nonsense probably null
R4490:Usp29 UTSW 7 6961950 missense possibly damaging 0.68
R4598:Usp29 UTSW 7 6962480 missense probably benign 0.06
R4606:Usp29 UTSW 7 6963357 splice site probably null
R4670:Usp29 UTSW 7 6962915 missense possibly damaging 0.91
R4777:Usp29 UTSW 7 6962748 missense probably benign 0.07
R4783:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4785:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4896:Usp29 UTSW 7 6962159 missense probably benign 0.29
R4915:Usp29 UTSW 7 6961505 missense probably benign
R4944:Usp29 UTSW 7 6961928 missense possibly damaging 0.92
R5004:Usp29 UTSW 7 6962159 missense probably benign 0.29
R5171:Usp29 UTSW 7 6962075 missense probably damaging 0.99
R5268:Usp29 UTSW 7 6961584 missense probably damaging 0.98
R5572:Usp29 UTSW 7 6962192 missense probably benign 0.12
R5933:Usp29 UTSW 7 6961745 missense probably benign
R6694:Usp29 UTSW 7 6962277 missense probably benign 0.03
R7389:Usp29 UTSW 7 6963458 missense possibly damaging 0.82
R7446:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7447:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7535:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7537:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R8081:Usp29 UTSW 7 6963630 missense probably benign 0.02
R8233:Usp29 UTSW 7 6962407 missense probably benign 0.12
R8703:Usp29 UTSW 7 6961322 missense probably benign 0.32
R8725:Usp29 UTSW 7 6962918 missense probably damaging 0.98
R8727:Usp29 UTSW 7 6962918 missense probably damaging 0.98
R8844:Usp29 UTSW 7 6961892 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTTCTCAAGTACACATTGAGGAGAC -3'
(R):5'- CTAGTTCTGGCTCCAGCATG -3'

Sequencing Primer
(F):5'- GACTCCCCAGGGTCCTCATTG -3'
(R):5'- AGGCCTCTCTGCTGCTG -3'
Posted On2015-05-14