Incidental Mutation 'R4042:Miga2'
ID315761
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Namemitoguardin 2
SynonymsFam73b, R74766, 5730472N09Rik
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30364233-30385521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30367726 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 12 (I12T)
Ref Sequence ENSEMBL: ENSMUSP00000135519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000116543] [ENSMUST00000140075] [ENSMUST00000142801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077977
AA Change: I12T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858
AA Change: I12T

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100214
AA Change: I12T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858
AA Change: I12T

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116543
SMART Domains Protein: ENSMUSP00000135126
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 1 91 3.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137441
Predicted Effect possibly damaging
Transcript: ENSMUST00000140075
AA Change: I12T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858
AA Change: I12T

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142801
AA Change: I12T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118253
Gene: ENSMUSG00000026858
AA Change: I12T

DomainStartEndE-ValueType
Pfam:DUF2217 30 139 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198501
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30367717 missense probably benign 0.04
IGL01353:Miga2 APN 2 30371233 critical splice donor site probably null
IGL01679:Miga2 APN 2 30378250 missense probably benign 0.07
IGL03113:Miga2 APN 2 30384010 missense possibly damaging 0.96
uncertain UTSW 2 30371196 missense probably benign 0.00
R0620:Miga2 UTSW 2 30381744 unclassified probably benign
R1698:Miga2 UTSW 2 30377997 missense probably damaging 1.00
R1729:Miga2 UTSW 2 30368968 missense probably damaging 1.00
R1994:Miga2 UTSW 2 30381988 missense probably damaging 1.00
R2377:Miga2 UTSW 2 30383990 nonsense probably null
R2891:Miga2 UTSW 2 30378294 splice site probably null
R2892:Miga2 UTSW 2 30378294 splice site probably null
R2893:Miga2 UTSW 2 30378294 splice site probably null
R3788:Miga2 UTSW 2 30371225 nonsense probably null
R5214:Miga2 UTSW 2 30371196 missense probably benign 0.00
R5750:Miga2 UTSW 2 30371565 missense probably damaging 1.00
R5928:Miga2 UTSW 2 30368863 splice site probably benign
R6134:Miga2 UTSW 2 30371217 missense probably benign 0.00
R6209:Miga2 UTSW 2 30381662 missense probably damaging 1.00
R6860:Miga2 UTSW 2 30371163 missense probably benign 0.15
R7373:Miga2 UTSW 2 30382071 missense probably damaging 1.00
R7884:Miga2 UTSW 2 30371204 missense probably benign 0.02
R8370:Miga2 UTSW 2 30375743 frame shift probably null
R8371:Miga2 UTSW 2 30375743 frame shift probably null
R8374:Miga2 UTSW 2 30375743 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGACCTGTTATGTGTGCC -3'
(R):5'- TCCTTAGGGAAACGATACCAGATATAC -3'

Sequencing Primer
(F):5'- GTTATGTGTGCCCCTGTCCTG -3'
(R):5'- ATTGTGATGCACTGACCCATGAG -3'
Posted On2015-05-15