Incidental Mutation 'R4062:Plagl1'
ID315914
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Namepleiomorphic adenoma gene-like 1
SynonymsZac1
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R4062 (G1)
Quality Score115
Status Not validated
Chromosome10
Chromosomal Location13060504-13131694 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC at 13128771 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
Predicted Effect probably benign
Transcript: ENSMUST00000121325
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121646
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121766
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126880
Predicted Effect probably benign
Transcript: ENSMUST00000130313
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141068
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably benign
Transcript: ENSMUST00000193426
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13127872 unclassified probably benign
R0554:Plagl1 UTSW 10 13127182 missense probably benign 0.07
R0842:Plagl1 UTSW 10 13128554 unclassified probably benign
R0967:Plagl1 UTSW 10 13128242 unclassified probably benign
R1610:Plagl1 UTSW 10 13128962 unclassified probably benign
R2002:Plagl1 UTSW 10 13128658 unclassified probably benign
R2107:Plagl1 UTSW 10 13128647 unclassified probably benign
R2108:Plagl1 UTSW 10 13128647 unclassified probably benign
R2191:Plagl1 UTSW 10 13128941 unclassified probably benign
R4061:Plagl1 UTSW 10 13128771 unclassified probably benign
R4631:Plagl1 UTSW 10 13127999 unclassified probably benign
R4924:Plagl1 UTSW 10 13127557 missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13127261 missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13128175 unclassified probably benign
R5893:Plagl1 UTSW 10 13128194 unclassified probably benign
R5971:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13127895 unclassified probably benign
R6138:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13127231 missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13128062 unclassified probably benign
R6970:Plagl1 UTSW 10 13125116 missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13128233 unclassified probably benign
U15987:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
Z1176:Plagl1 UTSW 10 13128716
Predicted Primers PCR Primer
(F):5'- GTGAATAGCACCATCCCTGTG -3'
(R):5'- GCACTCACTGCTATTTGGGC -3'

Sequencing Primer
(F):5'- ATAACCTGTCTGGCGCAG -3'
(R):5'- CTGGCTGTGGCTCTTCCG -3'
Posted On2015-05-15