Mutagenetix > Incidental Mutation

Incidental Mutation 'R1014:Tlr5'

95953

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

039118-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.307) question?

Stock #

R1014 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 182975677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 849 (G849R)

Ref Sequence

ENSEMBL: ENSMUSP00000141318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110997
AA Change: G849R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: G849R

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191820
AA Change: G835R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: G835R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193687
AA Change: G849R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: G849R

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195603

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	T	C	4: 126,506,785	R712G	probably damaging	Het
Arg1	C	A	10: 24,916,860	V159L	probably benign	Het
Caap1	C	T	4: 94,549,146	C193Y	probably benign	Het
Cdh12	A	T	15: 21,492,620	M242L	probably damaging	Het
Col19a1	A	T	1: 24,301,273		probably null	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
D430041D05Rik	T	C	2: 104,258,329	T101A	possibly damaging	Het
Dll4	T	C	2: 119,331,157	C407R	probably damaging	Het
Ebf4	T	C	2: 130,365,468	S484P	probably benign	Het
Gm10300	A	G	4: 132,074,712		probably benign	Het
Lyst	T	C	13: 13,634,060	I105T	possibly damaging	Het
Mrgprx2	A	G	7: 48,482,558		probably null	Het
Musk	T	C	4: 58,354,156	L403P	possibly damaging	Het
Myh11	T	C	16: 14,236,410	K363R	possibly damaging	Het
Nadk2	T	C	15: 9,091,254	F202L	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nup210l	C	T	3: 90,170,048	T897M	possibly damaging	Het
Olfr651	T	C	7: 104,553,176	W86R	probably damaging	Het
Pcdh17	A	G	14: 84,447,488	D465G	probably damaging	Het
Pcdhb11	T	A	18: 37,423,369	L584Q	probably damaging	Het
Pcdhb5	T	C	18: 37,322,250	L561P	probably damaging	Het
Pck2	A	G	14: 55,542,410	S12G	probably benign	Het
Pcsk1	A	G	13: 75,132,234	D726G	probably damaging	Het
Pcsk5	G	T	19: 17,564,830	A799E	probably damaging	Het
Pkp3	A	G	7: 141,082,826	Y117C	probably benign	Het
Poldip2	T	A	11: 78,515,162	D106E	probably damaging	Het
Ppm1d	C	A	11: 85,337,154	H299N	probably damaging	Het
Ptprz1	A	G	6: 23,000,644	Y911C	probably damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rtf1	T	G	2: 119,720,246	S329A	possibly damaging	Het
Slc12a2	T	C	18: 57,921,810	I841T	probably benign	Het
Slc2a3	T	C	6: 122,731,566	I367V	possibly damaging	Het
Slc30a8	A	G	15: 52,331,597	T251A	probably damaging	Het
Spryd3	T	A	15: 102,133,531	N19Y	probably damaging	Het
Tll2	A	T	19: 41,103,851	Y516N	probably damaging	Het
Wdr64	A	G	1: 175,755,626	E376G	probably damaging	Het
Zfp318	GAA	GAANAA	17: 46,412,536		probably null	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0552:Tlr5	UTSW	1	182975696	splice site	probably null
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4794:Tlr5	UTSW	1	182973896	missense	probably benign	0.00
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6056:Tlr5	UTSW	1	182974038	missense	possibly damaging	0.76
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7135:Tlr5	UTSW	1	182975523	missense	possibly damaging	0.87
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7255:Tlr5	UTSW	1	182974316	missense	probably damaging	1.00
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
R8887:Tlr5	UTSW	1	182973767	missense	probably benign	0.07
R9116:Tlr5	UTSW	1	182974595	missense	probably benign
R9224:Tlr5	UTSW	1	182975128	missense	probably benign	0.10
R9284:Tlr5	UTSW	1	182973812	missense	probably benign	0.00
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGCAGACACTTCCTGAAGGATGG -3'
(R):5'- GAGGCAGCTTTCTGGACCTCTTAC -3'

Sequencing Primer
(F):5'- GTATGCCCAGAGCCGGAG -3'
(R):5'- TGAGACAAAGCTCCCTGTTG -3'

Posted On

2014-01-05