Incidental Mutation 'R4232:Rtp4'
ID320934
Institutional Source Beutler Lab
Gene Symbol Rtp4
Ensembl Gene ENSMUSG00000033355
Gene Namereceptor transporter protein 4
Synonyms5830458K16Rik
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23520291-23614222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23613083 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 122 (N122D)
Ref Sequence ENSEMBL: ENSMUSP00000147442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038423] [ENSMUST00000209422] [ENSMUST00000210901] [ENSMUST00000211349] [ENSMUST00000211569]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038423
AA Change: N122D

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041091
Gene: ENSMUSG00000033355
AA Change: N122D

DomainStartEndE-ValueType
zf-3CxxC 50 163 8.52e-52 SMART
low complexity region 175 197 N/A INTRINSIC
transmembrane domain 231 248 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209422
AA Change: N122D

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210901
AA Change: N122D

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211349
Predicted Effect probably benign
Transcript: ENSMUST00000211569
AA Change: N122D

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Rtp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Rtp4 APN 16 23613254 missense probably benign 0.18
IGL02942:Rtp4 APN 16 23612954 missense probably benign 0.01
PIT4696001:Rtp4 UTSW 16 23613454 missense probably benign 0.23
R0049:Rtp4 UTSW 16 23612929 missense probably benign 0.04
R0049:Rtp4 UTSW 16 23612929 missense probably benign 0.04
R1694:Rtp4 UTSW 16 23613120 makesense probably null
R2060:Rtp4 UTSW 16 23612940 missense probably damaging 1.00
R2088:Rtp4 UTSW 16 23613213 missense possibly damaging 0.86
R4493:Rtp4 UTSW 16 23610077 missense probably benign 0.23
R4646:Rtp4 UTSW 16 23610040 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGCTGCAGAAGTTGGACCTC -3'
(R):5'- CAGCTCTTTGATGGGGAGGAAC -3'

Sequencing Primer
(F):5'- AGAAGTTGGACCTCTGCTCAG -3'
(R):5'- ACTCTTTGGTAATGGAGATGGAGATC -3'
Posted On2015-06-12