Incidental Mutation 'R4232:Tmprss7'
ID320935
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Nametransmembrane serine protease 7
Synonymsmatriptase-3, B230219I23Rik, LOC385645
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45656315-45693658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45656573 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 775 (D775E)
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036732] [ENSMUST00000114562]
Predicted Effect probably benign
Transcript: ENSMUST00000036732
SMART Domains Protein: ENSMUSP00000037651
Gene: ENSMUSG00000033187

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114562
AA Change: D775E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177
AA Change: D775E

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170951
Meta Mutation Damage Score 0.5146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45663368 missense probably benign
IGL00985:Tmprss7 APN 16 45662322 missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45660789 missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45684574 missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45664175 missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45663343 missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45680634 missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45681593 missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45669528 missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45656455 missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45680748 missense probably benign
amalgum UTSW 16 45683510 missense probably benign 0.15
fusion UTSW 16 45690760 missense probably damaging 1.00
steely UTSW 16 45667606 nonsense probably null
P0019:Tmprss7 UTSW 16 45680733 missense probably benign
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45667596 missense probably damaging 1.00
R0178:Tmprss7 UTSW 16 45690843 missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45656457 missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45680638 missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45669551 missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45677962 nonsense probably null
R0783:Tmprss7 UTSW 16 45667606 nonsense probably null
R1447:Tmprss7 UTSW 16 45680670 missense probably benign
R1538:Tmprss7 UTSW 16 45679390 missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45662153 critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45656548 nonsense probably null
R1932:Tmprss7 UTSW 16 45684593 nonsense probably null
R2257:Tmprss7 UTSW 16 45686333 missense possibly damaging 0.47
R3840:Tmprss7 UTSW 16 45660832 nonsense probably null
R4332:Tmprss7 UTSW 16 45686327 missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45679348 missense probably benign
R4712:Tmprss7 UTSW 16 45690760 missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45663316 missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45660889 missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45669528 missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45656448 missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45660904 missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45686430 missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45673905 nonsense probably null
R6235:Tmprss7 UTSW 16 45658122 missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45669573 missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45690963 missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45677954 missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45690893 missense probably benign
R7634:Tmprss7 UTSW 16 45663274 missense probably benign 0.00
R7747:Tmprss7 UTSW 16 45683510 missense probably benign 0.15
R7776:Tmprss7 UTSW 16 45667651 missense probably benign 0.03
R7777:Tmprss7 UTSW 16 45660600 splice site probably null
R8222:Tmprss7 UTSW 16 45658098 missense probably damaging 0.99
T0975:Tmprss7 UTSW 16 45680733 missense probably benign
Z1176:Tmprss7 UTSW 16 45662256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATGTGCTCAATCTGACACTTTC -3'
(R):5'- CTACTCCTTTCACAGATGCAATG -3'

Sequencing Primer
(F):5'- GTCACAGTTAACAATCCATCTGTTAC -3'
(R):5'- CTCCTTTCACAGATGCAATGAATAC -3'
Posted On2015-06-12