Incidental Mutation 'R4345:Tgfbrap1'
ID324282
Institutional Source Beutler Lab
Gene Symbol Tgfbrap1
Ensembl Gene ENSMUSG00000070939
Gene Nametransforming growth factor, beta receptor associated protein 1
Synonyms3110018K12Rik
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location43047200-43098637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43056706 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000140132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095014] [ENSMUST00000186694] [ENSMUST00000188728]
Predicted Effect probably benign
Transcript: ENSMUST00000095014
AA Change: D524G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092624
Gene: ENSMUSG00000070939
AA Change: D524G

DomainStartEndE-ValueType
Pfam:CNH 30 293 3.3e-15 PFAM
Pfam:Vps39_1 448 550 3.3e-26 PFAM
Pfam:Clathrin 572 730 5.3e-13 PFAM
Pfam:Vps39_2 738 846 2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185980
Predicted Effect probably benign
Transcript: ENSMUST00000186694
AA Change: D524G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140132
Gene: ENSMUSG00000070939
AA Change: D524G

DomainStartEndE-ValueType
Pfam:CNH 29 293 1.4e-17 PFAM
Pfam:Vps39_1 448 550 4.5e-26 PFAM
Pfam:Clathrin 571 730 8.4e-13 PFAM
Pfam:Vps39_2 738 846 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188598
Predicted Effect probably benign
Transcript: ENSMUST00000188728
SMART Domains Protein: ENSMUSP00000140169
Gene: ENSMUSG00000070939

DomainStartEndE-ValueType
Pfam:Vps39_1 218 254 3.6e-7 PFAM
Meta Mutation Damage Score 0.2780 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to transforming growth factor-beta (TGF-beta) receptors and plays a role in TGF-beta signaling. The encoded protein acts as a chaprone in signaling downstream of TGF-beta. It is involved in signal-dependent association with SMAD4. The protein is also a component of mammalian CORVET, a multisubunit tethering protein complex that is involved in fusion of early endosomes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Tgfbrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tgfbrap1 APN 1 43060123 missense probably damaging 0.98
IGL02142:Tgfbrap1 APN 1 43062592 missense probably damaging 1.00
IGL02386:Tgfbrap1 APN 1 43075821 missense probably damaging 1.00
IGL02667:Tgfbrap1 APN 1 43067620 missense probably benign 0.04
IGL03039:Tgfbrap1 APN 1 43075928 missense possibly damaging 0.76
askew UTSW 1 43059129 missense probably benign 0.22
R0245:Tgfbrap1 UTSW 1 43075592 missense possibly damaging 0.73
R0609:Tgfbrap1 UTSW 1 43060141 missense probably benign 0.24
R0624:Tgfbrap1 UTSW 1 43059129 missense probably benign 0.22
R1111:Tgfbrap1 UTSW 1 43051976 missense probably benign 0.07
R1184:Tgfbrap1 UTSW 1 43049696 missense possibly damaging 0.65
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1571:Tgfbrap1 UTSW 1 43049813 missense probably benign 0.21
R1615:Tgfbrap1 UTSW 1 43051985 missense probably benign 0.00
R1704:Tgfbrap1 UTSW 1 43054656 missense probably benign 0.00
R1773:Tgfbrap1 UTSW 1 43075352 missense probably damaging 1.00
R1834:Tgfbrap1 UTSW 1 43071635 missense probably damaging 1.00
R2019:Tgfbrap1 UTSW 1 43054517 critical splice donor site probably null
R2038:Tgfbrap1 UTSW 1 43054634 nonsense probably null
R2926:Tgfbrap1 UTSW 1 43075629 missense probably damaging 1.00
R3842:Tgfbrap1 UTSW 1 43059154 missense probably damaging 0.98
R5133:Tgfbrap1 UTSW 1 43075506 missense probably damaging 0.96
R5200:Tgfbrap1 UTSW 1 43075643 missense probably damaging 1.00
R5382:Tgfbrap1 UTSW 1 43075865 missense probably benign 0.01
R5715:Tgfbrap1 UTSW 1 43059937 missense possibly damaging 0.64
R6860:Tgfbrap1 UTSW 1 43067599 missense possibly damaging 0.63
R6921:Tgfbrap1 UTSW 1 43051896 missense probably benign
R6937:Tgfbrap1 UTSW 1 43051904 missense probably damaging 0.99
R7090:Tgfbrap1 UTSW 1 43071565 missense probably damaging 0.99
R7359:Tgfbrap1 UTSW 1 43075533 missense probably damaging 1.00
R8318:Tgfbrap1 UTSW 1 43056669 missense probably damaging 0.97
R8354:Tgfbrap1 UTSW 1 43075910 missense probably damaging 1.00
X0028:Tgfbrap1 UTSW 1 43071650 missense probably damaging 1.00
Z1176:Tgfbrap1 UTSW 1 43060147 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCCCTCCACCTAAAGTTG -3'
(R):5'- TGCTTGTGAATGCTCAGCTTATAG -3'

Sequencing Primer
(F):5'- CTCCACCTAAAGTTGAGGGG -3'
(R):5'- CTCAGCGAATTCTACATAATACA -3'
Posted On2015-06-24