Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Tgfbrap1'

324282

Institutional Source

Beutler Lab

Gene Symbol

Tgfbrap1

Ensembl Gene

ENSMUSG00000070939

Gene Name

transforming growth factor, beta receptor associated protein 1

Synonyms

3110018K12Rik

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43047200-43098637 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43056706 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 524 (D524G)

Ref Sequence

ENSEMBL: ENSMUSP00000140132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095014] [ENSMUST00000186694] [ENSMUST00000188728]

Predicted Effect

probably benign
Transcript: ENSMUST00000095014
AA Change: D524G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000092624
Gene: ENSMUSG00000070939
AA Change: D524G

Domain	Start	End	E-Value	Type
Pfam:CNH	30	293	3.3e-15	PFAM
Pfam:Vps39_1	448	550	3.3e-26	PFAM
Pfam:Clathrin	572	730	5.3e-13	PFAM
Pfam:Vps39_2	738	846	2e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185980

Predicted Effect

probably benign
Transcript: ENSMUST00000186694
AA Change: D524G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000140132
Gene: ENSMUSG00000070939
AA Change: D524G

Domain	Start	End	E-Value	Type
Pfam:CNH	29	293	1.4e-17	PFAM
Pfam:Vps39_1	448	550	4.5e-26	PFAM
Pfam:Clathrin	571	730	8.4e-13	PFAM
Pfam:Vps39_2	738	846	4e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188598

Predicted Effect

probably benign
Transcript: ENSMUST00000188728

SMART Domains

Protein: ENSMUSP00000140169
Gene: ENSMUSG00000070939

Domain	Start	End	E-Value	Type
Pfam:Vps39_1	218	254	3.6e-7	PFAM

Meta Mutation Damage Score

0.2780

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to transforming growth factor-beta (TGF-beta) receptors and plays a role in TGF-beta signaling. The encoded protein acts as a chaprone in signaling downstream of TGF-beta. It is involved in signal-dependent association with SMAD4. The protein is also a component of mammalian CORVET, a multisubunit tethering protein complex that is involved in fusion of early endosomes. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gramd4	T	C	15: 86,134,893	S581P	probably damaging	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Map4k3	A	G	17: 80,597,551		probably null	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Pdzd8	T	C	19: 59,300,128	T947A	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Tgfbrap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Tgfbrap1	APN	1	43060123	missense	probably damaging	0.98
IGL02142:Tgfbrap1	APN	1	43062592	missense	probably damaging	1.00
IGL02386:Tgfbrap1	APN	1	43075821	missense	probably damaging	1.00
IGL02667:Tgfbrap1	APN	1	43067620	missense	probably benign	0.04
IGL03039:Tgfbrap1	APN	1	43075928	missense	possibly damaging	0.76
askew	UTSW	1	43059129	missense	probably benign	0.22
R0245:Tgfbrap1	UTSW	1	43075592	missense	possibly damaging	0.73
R0609:Tgfbrap1	UTSW	1	43060141	missense	probably benign	0.24
R0624:Tgfbrap1	UTSW	1	43059129	missense	probably benign	0.22
R1111:Tgfbrap1	UTSW	1	43051976	missense	probably benign	0.07
R1184:Tgfbrap1	UTSW	1	43049696	missense	possibly damaging	0.65
R1469:Tgfbrap1	UTSW	1	43075458	missense	probably benign	0.03
R1469:Tgfbrap1	UTSW	1	43075458	missense	probably benign	0.03
R1571:Tgfbrap1	UTSW	1	43049813	missense	probably benign	0.21
R1615:Tgfbrap1	UTSW	1	43051985	missense	probably benign	0.00
R1704:Tgfbrap1	UTSW	1	43054656	missense	probably benign	0.00
R1773:Tgfbrap1	UTSW	1	43075352	missense	probably damaging	1.00
R1834:Tgfbrap1	UTSW	1	43071635	missense	probably damaging	1.00
R2019:Tgfbrap1	UTSW	1	43054517	critical splice donor site	probably null
R2038:Tgfbrap1	UTSW	1	43054634	nonsense	probably null
R2926:Tgfbrap1	UTSW	1	43075629	missense	probably damaging	1.00
R3842:Tgfbrap1	UTSW	1	43059154	missense	probably damaging	0.98
R5133:Tgfbrap1	UTSW	1	43075506	missense	probably damaging	0.96
R5200:Tgfbrap1	UTSW	1	43075643	missense	probably damaging	1.00
R5382:Tgfbrap1	UTSW	1	43075865	missense	probably benign	0.01
R5715:Tgfbrap1	UTSW	1	43059937	missense	possibly damaging	0.64
R6860:Tgfbrap1	UTSW	1	43067599	missense	possibly damaging	0.63
R6921:Tgfbrap1	UTSW	1	43051896	missense	probably benign
R6937:Tgfbrap1	UTSW	1	43051904	missense	probably damaging	0.99
R7090:Tgfbrap1	UTSW	1	43071565	missense	probably damaging	0.99
R7359:Tgfbrap1	UTSW	1	43075533	missense	probably damaging	1.00
R8318:Tgfbrap1	UTSW	1	43056669	missense	probably damaging	0.97
R8354:Tgfbrap1	UTSW	1	43075910	missense	probably damaging	1.00
X0028:Tgfbrap1	UTSW	1	43071650	missense	probably damaging	1.00
Z1176:Tgfbrap1	UTSW	1	43060147	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCCCCTCCACCTAAAGTTG -3'
(R):5'- TGCTTGTGAATGCTCAGCTTATAG -3'

Sequencing Primer
(F):5'- CTCCACCTAAAGTTGAGGGG -3'
(R):5'- CTCAGCGAATTCTACATAATACA -3'

Posted On

2015-06-24