Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Gramd4'

324310

Institutional Source

Beutler Lab

Gene Symbol

Gramd4

Ensembl Gene

ENSMUSG00000035900

Gene Name

GRAM domain containing 4

Synonyms

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86057695-86137634 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86134893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 581 (S581P)

Ref Sequence

ENSEMBL: ENSMUSP00000086321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]

AlphaFold

Q8CB44

Predicted Effect

probably benign
Transcript: ENSMUST00000044332

SMART Domains

Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891

Domain	Start	End	E-Value	Type
Blast:PH	8	126	9e-39	BLAST
Pfam:DAGK_cat	132	274	1.1e-31	PFAM
low complexity region	356	367	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000088931
AA Change: S581P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900
AA Change: S581P

Domain	Start	End	E-Value	Type
coiled coil region	132	190	N/A	INTRINSIC
transmembrane domain	301	323	N/A	INTRINSIC
transmembrane domain	400	422	N/A	INTRINSIC
GRAM	500	578	8.41e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123349

SMART Domains

Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000138134

SMART Domains

Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
GRAM	475	553	3.86e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150767

Meta Mutation Damage Score

0.3094

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Map4k3	A	G	17: 80,597,551		probably null	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Pdzd8	T	C	19: 59,300,128	T947A	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Tgfbrap1	T	C	1: 43,056,706	D524G	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Gramd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02983:Gramd4	APN	15	86127018	missense	probably damaging	0.97
Grasping	UTSW	15	86091503	missense	probably damaging	0.99
R0053:Gramd4	UTSW	15	86130138	splice site	probably benign
R0622:Gramd4	UTSW	15	86091389	missense	probably damaging	1.00
R1401:Gramd4	UTSW	15	86125196	missense	probably damaging	1.00
R1741:Gramd4	UTSW	15	86091529	splice site	probably null
R1840:Gramd4	UTSW	15	86130192	critical splice donor site	probably null
R1968:Gramd4	UTSW	15	86132905	missense	probably damaging	1.00
R2909:Gramd4	UTSW	15	86122183	nonsense	probably null
R4431:Gramd4	UTSW	15	86130160	missense	probably damaging	1.00
R4832:Gramd4	UTSW	15	86134856	missense	probably benign
R5164:Gramd4	UTSW	15	86100831	missense	probably benign	0.16
R5216:Gramd4	UTSW	15	86134785	critical splice acceptor site	probably null
R5898:Gramd4	UTSW	15	86100784	missense	probably damaging	1.00
R5959:Gramd4	UTSW	15	86127557	missense	probably damaging	0.99
R6303:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6304:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6678:Gramd4	UTSW	15	86091503	missense	probably damaging	0.99
R6678:Gramd4	UTSW	15	86091504	missense	possibly damaging	0.52
R6980:Gramd4	UTSW	15	86131969	missense	probably benign	0.17
R7371:Gramd4	UTSW	15	86135406	missense	probably benign	0.04
R7557:Gramd4	UTSW	15	86100900	nonsense	probably null
R7922:Gramd4	UTSW	15	86131958	missense	probably benign	0.07
R8874:Gramd4	UTSW	15	86100892	missense	probably damaging	0.97
R9127:Gramd4	UTSW	15	86091324	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCCTGTTGCTAGGATGTCC -3'
(R):5'- AAGCTTTCTGGACCTTGTGTC -3'

Sequencing Primer
(F):5'- TAGGATGTCCTAGGCCTGC -3'
(R):5'- ACCTTGTGTCCATGGAGTAGG -3'

Posted On

2015-06-24