Incidental Mutation 'R4345:Gramd4'
ID 324310
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene Name GRAM domain containing 4
Synonyms
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4345 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 86057695-86137634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86134893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 581 (S581P)
Ref Sequence ENSEMBL: ENSMUSP00000086321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]
AlphaFold Q8CB44
Predicted Effect probably benign
Transcript: ENSMUST00000044332
SMART Domains Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891

DomainStartEndE-ValueType
Blast:PH 8 126 9e-39 BLAST
Pfam:DAGK_cat 132 274 1.1e-31 PFAM
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088931
AA Change: S581P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900
AA Change: S581P

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123349
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150767
Meta Mutation Damage Score 0.3094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1741:Gramd4 UTSW 15 86091529 splice site probably null
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5216:Gramd4 UTSW 15 86134785 critical splice acceptor site probably null
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R5959:Gramd4 UTSW 15 86127557 missense probably damaging 0.99
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6304:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
R7922:Gramd4 UTSW 15 86131958 missense probably benign 0.07
R8874:Gramd4 UTSW 15 86100892 missense probably damaging 0.97
R9127:Gramd4 UTSW 15 86091324 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTGTTGCTAGGATGTCC -3'
(R):5'- AAGCTTTCTGGACCTTGTGTC -3'

Sequencing Primer
(F):5'- TAGGATGTCCTAGGCCTGC -3'
(R):5'- ACCTTGTGTCCATGGAGTAGG -3'
Posted On 2015-06-24