Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Trpm3'

324316

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22139119-22989884 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22897697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 568 (S568C)

Ref Sequence

ENSEMBL: ENSMUSP00000074328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably benign
Transcript: ENSMUST00000037901
AA Change: S566C

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: S566C

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000074770
AA Change: S568C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: S568C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087576
AA Change: S568C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: S568C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099564
AA Change: S408C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387
AA Change: S408C

Domain	Start	End	E-Value	Type
low complexity region	451	463	N/A	INTRINSIC
low complexity region	506	521	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	653	672	N/A	INTRINSIC
transmembrane domain	714	736	N/A	INTRINSIC
Pfam:Ion_trans	748	919	1.5e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000099569
AA Change: S556C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: S556C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Meta Mutation Damage Score

0.1435

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gramd4	T	C	15: 86,134,893	S581P	probably damaging	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Map4k3	A	G	17: 80,597,551		probably null	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Pdzd8	T	C	19: 59,300,128	T947A	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Tgfbrap1	T	C	1: 43,056,706	D524G	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22987659	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22900159	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22987071	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22715246	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22987127	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22914474	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22711719	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22902069	nonsense	probably null
IGL02324:Trpm3	APN	19	22698779	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22901119	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22889412	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22914465	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22926071	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22856718	missense	probably damaging	1.00
bit	UTSW	19	22987869	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22897686	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22715331	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22987916	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22715356	splice site	probably null
R0268:Trpm3	UTSW	19	22897521	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22988054	missense	probably benign
R0481:Trpm3	UTSW	19	22901071	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22698778	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22987812	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22987789	missense	probably benign
R0883:Trpm3	UTSW	19	22978654	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22988043	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1513:Trpm3	UTSW	19	22986872	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22901221	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22978334	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22889445	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22733024	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22139155	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22982712	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22711907	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22885412	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22926082	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22982583	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22733034	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22986990	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22448377	missense	probably benign
R3774:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3774:Trpm3	UTSW	19	22987975	missense	probably benign	0.03
R3776:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22987449	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22901160	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22987564	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22978638	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22987292	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22978330	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22987869	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22902142	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22978624	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22987388	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22987781	missense	probably benign
R4713:Trpm3	UTSW	19	22889435	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22715295	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22711712	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22698766	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22885349	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22766756	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22918766	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22904714	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22448341	nonsense	probably null
R5213:Trpm3	UTSW	19	22697454	nonsense	probably null
R5358:Trpm3	UTSW	19	22925968	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22926184	nonsense	probably null
R5382:Trpm3	UTSW	19	22885341	splice site	probably null
R5509:Trpm3	UTSW	19	22987258	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22987814	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22910054	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22901305	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22926113	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22987983	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22978582	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22978684	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22902193	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22978334	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22897796	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22926094	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22918790	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22904784	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22918696	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22715276	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22987408	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22698862	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22910137	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22918676	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22988216	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22978588	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22910129	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22766670	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22925944	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22918760	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22978381	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22918640	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22448332	missense	probably benign
Z1176:Trpm3	UTSW	19	22987490	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCAAGCGAGAGTATCCAGG -3'
(R):5'- CAAGGGGTTATACCTTAAATCTCTCC -3'

Sequencing Primer
(F):5'- CAAGCGAGAGTATCCAGGTTTCG -3'
(R):5'- CTTCCTAGTCTTCCCCAAATAGC -3'

Posted On

2015-06-24