Incidental Mutation 'R4345:Trpm3'
ID324316
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Nametransient receptor potential cation channel, subfamily M, member 3
SynonymsB930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location22139119-22989884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22897697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 568 (S568C)
Ref Sequence ENSEMBL: ENSMUSP00000074328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099569]
Predicted Effect probably benign
Transcript: ENSMUST00000037901
AA Change: S566C

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: S566C

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074770
AA Change: S568C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: S568C

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087576
AA Change: S568C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: S568C

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099564
AA Change: S408C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387
AA Change: S408C

DomainStartEndE-ValueType
low complexity region 451 463 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 653 672 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
Pfam:Ion_trans 748 919 1.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099569
AA Change: S556C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: S556C

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.1435 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22987659 missense probably benign 0.00
IGL00773:Trpm3 APN 19 22900159 missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22987071 missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22715246 missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22987127 missense probably benign 0.01
IGL01818:Trpm3 APN 19 22914474 missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22711719 missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22902069 nonsense probably null
IGL02324:Trpm3 APN 19 22698779 missense probably benign 0.25
IGL02947:Trpm3 APN 19 22901119 missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22889412 missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22914465 missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22926071 critical splice donor site probably null
IGL03354:Trpm3 APN 19 22856718 missense probably damaging 1.00
bit UTSW 19 22987869 missense probably benign 0.00
P0041:Trpm3 UTSW 19 22897686 missense probably benign 0.01
R0001:Trpm3 UTSW 19 22715331 missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22987916 missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22715356 splice site probably null
R0268:Trpm3 UTSW 19 22897521 critical splice donor site probably null
R0299:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22988054 missense probably benign
R0481:Trpm3 UTSW 19 22901071 missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22698778 missense probably benign 0.00
R0499:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22987812 missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22987789 missense probably benign
R0883:Trpm3 UTSW 19 22978654 missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22988043 missense probably benign 0.02
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1513:Trpm3 UTSW 19 22986872 missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22901221 missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22978334 missense probably benign 0.39
R1569:Trpm3 UTSW 19 22889445 critical splice donor site probably null
R1598:Trpm3 UTSW 19 22733024 missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22139155 missense probably benign 0.00
R1616:Trpm3 UTSW 19 22982712 missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22711907 missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22885412 missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22926082 missense possibly damaging 0.56
R2002:Trpm3 UTSW 19 22982583 missense probably damaging 1.00
R2249:Trpm3 UTSW 19 22733034 missense probably benign 0.15
R3719:Trpm3 UTSW 19 22986990 missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22448377 missense probably benign
R3774:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3774:Trpm3 UTSW 19 22987975 missense probably benign 0.03
R3776:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22987449 missense probably benign 0.00
R3899:Trpm3 UTSW 19 22901160 missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22987564 missense probably benign 0.00
R4238:Trpm3 UTSW 19 22978638 missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22987292 missense probably benign 0.23
R4344:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22978330 missense probably benign 0.00
R4510:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4511:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4565:Trpm3 UTSW 19 22987869 missense probably benign 0.00
R4573:Trpm3 UTSW 19 22902142 missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22978624 missense probably benign 0.26
R4677:Trpm3 UTSW 19 22987388 missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22987781 missense probably benign
R4713:Trpm3 UTSW 19 22889435 missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22715295 missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22711712 missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22698766 missense probably benign 0.01
R5074:Trpm3 UTSW 19 22885349 missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22766756 missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22918766 missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22904714 missense probably benign 0.06
R5204:Trpm3 UTSW 19 22448341 nonsense probably null
R5213:Trpm3 UTSW 19 22697454 nonsense probably null
R5358:Trpm3 UTSW 19 22925968 missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22926184 nonsense probably null
R5382:Trpm3 UTSW 19 22885341 splice site probably null
R5509:Trpm3 UTSW 19 22987258 missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22987814 missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22910054 missense probably benign 0.01
R6433:Trpm3 UTSW 19 22901305 missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22926113 missense probably benign 0.04
R6630:Trpm3 UTSW 19 22987983 missense probably benign 0.00
R6640:Trpm3 UTSW 19 22978582 missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22926028 missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22978684 missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22902193 missense probably benign 0.27
R7467:Trpm3 UTSW 19 22978334 missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22897796 missense probably benign 0.28
R7600:Trpm3 UTSW 19 22926094 missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22918790 missense probably damaging 0.97
R7877:Trpm3 UTSW 19 22904784 missense probably benign 0.25
R8184:Trpm3 UTSW 19 22918696 missense possibly damaging 0.46
R8234:Trpm3 UTSW 19 22715276 missense possibly damaging 0.47
R8236:Trpm3 UTSW 19 22987408 missense probably benign 0.00
R8443:Trpm3 UTSW 19 22698862 missense possibly damaging 0.90
Z1176:Trpm3 UTSW 19 22987490 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCAAGCGAGAGTATCCAGG -3'
(R):5'- CAAGGGGTTATACCTTAAATCTCTCC -3'

Sequencing Primer
(F):5'- CAAGCGAGAGTATCCAGGTTTCG -3'
(R):5'- CTTCCTAGTCTTCCCCAAATAGC -3'
Posted On2015-06-24