Mutagenetix > Incidental Mutations

Incidental Mutation 'R4375:Cyp4b1'

325064

Institutional Source

Beutler Lab

Gene Symbol

Cyp4b1

Ensembl Gene

ENSMUSG00000028713

Gene Name

cytochrome P450, family 4, subfamily b, polypeptide 1

Synonyms

MMRRC Submission

041119-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115624725-115647723 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115636313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 191 (T191A)

Ref Sequence

ENSEMBL: ENSMUSP00000099768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102707]

AlphaFold

Q64462

Predicted Effect

probably benign
Transcript: ENSMUST00000102707
AA Change: T191A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: T191A

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:p450	46	501	1.3e-130	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000135569
AA Change: T67A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143237

Predicted Effect

unknown
Transcript: ENSMUST00000145841
AA Change: T101A

SMART Domains

Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: T101A

Domain	Start	End	E-Value	Type
Pfam:p450	1	375	3.5e-101	PFAM

Meta Mutation Damage Score

0.2226

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,561,628		probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cntnap1	A	G	11: 101,182,253	D561G	probably damaging	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Dapk1	A	T	13: 60,761,589	M1339L	probably benign	Het
Dpm3	T	C	3: 89,266,908	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,427,924	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Fam184b	T	C	5: 45,542,343	D577G	probably benign	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hsf2bp	C	T	17: 31,987,348	D270N	probably null	Het
Lactbl1	T	C	4: 136,637,591	V418A	possibly damaging	Het
Lifr	A	T	15: 7,166,898	M188L	probably benign	Het
Ltbp1	G	T	17: 75,312,997	G760V	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,240,946	L312P	possibly damaging	Het
Olfr365	T	A	2: 37,201,562	M107K	probably benign	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr898	T	C	9: 38,349,169	F23L	probably benign	Het
Pcdh17	T	C	14: 84,448,271	V726A	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Phf20l1	T	C	15: 66,615,222	S369P	probably benign	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Proser3	A	G	7: 30,540,671	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,725,410	T646M	probably benign	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snx9	G	A	17: 5,908,626	W292*	probably null	Het
St14	T	C	9: 31,090,458	I784V	probably benign	Het
Strc	A	G	2: 121,380,823	S14P	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ubap1	G	A	4: 41,371,850		probably null	Het
Zfr	T	C	15: 12,118,340		probably null	Het

Other mutations in Cyp4b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01677:Cyp4b1	APN	4	115636282	missense	probably damaging	0.97
IGL02484:Cyp4b1	APN	4	115647557	missense	probably benign	0.00
IGL03111:Cyp4b1	APN	4	115635869	splice site	probably benign
IGL03340:Cyp4b1	APN	4	115641879	missense	probably damaging	1.00
R0026:Cyp4b1	UTSW	4	115647521	missense	possibly damaging	0.95
R0026:Cyp4b1	UTSW	4	115647521	missense	possibly damaging	0.95
R0143:Cyp4b1	UTSW	4	115635874	missense	probably damaging	0.99
R0532:Cyp4b1	UTSW	4	115626876	missense	probably damaging	1.00
R0725:Cyp4b1	UTSW	4	115626827	missense	probably damaging	1.00
R0970:Cyp4b1	UTSW	4	115635636	missense	probably benign	0.07
R1084:Cyp4b1	UTSW	4	115640312	missense	probably benign	0.00
R1570:Cyp4b1	UTSW	4	115635963	missense	probably benign	0.00
R1626:Cyp4b1	UTSW	4	115641658	missense	probably damaging	1.00
R1966:Cyp4b1	UTSW	4	115625879	missense	probably benign	0.13
R2279:Cyp4b1	UTSW	4	115640360	missense	probably benign	0.23
R2396:Cyp4b1	UTSW	4	115641646	missense	probably benign	0.43
R2679:Cyp4b1	UTSW	4	115628697	missense	probably benign	0.01
R2885:Cyp4b1	UTSW	4	115635652	missense	probably damaging	1.00
R3176:Cyp4b1	UTSW	4	115625850	missense	possibly damaging	0.87
R3276:Cyp4b1	UTSW	4	115625850	missense	possibly damaging	0.87
R7221:Cyp4b1	UTSW	4	115635978	missense	possibly damaging	0.92
R7584:Cyp4b1	UTSW	4	115628687	missense	probably damaging	0.98
R7699:Cyp4b1	UTSW	4	115641965	missense	probably benign	0.06
R8867:Cyp4b1	UTSW	4	115635972	missense	possibly damaging	0.78
R9076:Cyp4b1	UTSW	4	115625227	missense	probably damaging	1.00
X0058:Cyp4b1	UTSW	4	115628778	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAAAGTGTCTCCCACCATGAGTAG -3'
(R):5'- GGAGTCTGCTACACATCTGG -3'

Sequencing Primer
(F):5'- CCATGAGTAGGCTCTGGACATATC -3'
(R):5'- GTCTGCTACACATCTGGGAATAAG -3'

Posted On

2015-07-06