Mutagenetix > Incidental Mutations

Incidental Mutation 'R4375:Phf20l1'

371086

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

041119-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R4375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66615222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 369 (S369P)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

probably benign
Transcript: ENSMUST00000048188
AA Change: S396P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: S396P

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229160
AA Change: S395P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229486

Predicted Effect

probably benign
Transcript: ENSMUST00000229576
AA Change: S396P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably benign
Transcript: ENSMUST00000230882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

probably benign
Transcript: ENSMUST00000230948
AA Change: S369P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,561,628		probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cntnap1	A	G	11: 101,182,253	D561G	probably damaging	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Cyp4b1	T	C	4: 115,636,313	T191A	probably benign	Het
Dapk1	A	T	13: 60,761,589	M1339L	probably benign	Het
Dpm3	T	C	3: 89,266,908	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,427,924	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Fam184b	T	C	5: 45,542,343	D577G	probably benign	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hsf2bp	C	T	17: 31,987,348	D270N	probably null	Het
Lactbl1	T	C	4: 136,637,591	V418A	possibly damaging	Het
Lifr	A	T	15: 7,166,898	M188L	probably benign	Het
Ltbp1	G	T	17: 75,312,997	G760V	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,240,946	L312P	possibly damaging	Het
Olfr365	T	A	2: 37,201,562	M107K	probably benign	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr898	T	C	9: 38,349,169	F23L	probably benign	Het
Pcdh17	T	C	14: 84,448,271	V726A	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Proser3	A	G	7: 30,540,671	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,725,410	T646M	probably benign	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snx9	G	A	17: 5,908,626	W292*	probably null	Het
St14	T	C	9: 31,090,458	I784V	probably benign	Het
Strc	A	G	2: 121,380,823	S14P	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ubap1	G	A	4: 41,371,850		probably null	Het
Zfr	T	C	15: 12,118,340		probably null	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGTTCCATGTTACTGTCTTTGAG -3'
(R):5'- CTGTTGCTGATTCTGAGAACTG -3'

Sequencing Primer
(F):5'- CCATGTTACTGTCTTTGAGTTCTAG -3'
(R):5'- GAACTGATGGAGAATGCTTTGCCATC -3'

Posted On

2016-02-16