Mutagenetix > Incidental Mutation

Incidental Mutation 'R4375:Pcdh17'

325077

Institutional Source

Beutler Lab

Gene Symbol

Pcdh17

Ensembl Gene

ENSMUSG00000035566

Gene Name

protocadherin 17

Synonyms

C030033F14Rik, LOC219228

MMRRC Submission

041119-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R4375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84443563-84539002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84448271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 726 (V726A)

Ref Sequence

ENSEMBL: ENSMUSP00000071325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071370]

AlphaFold

E9PXF0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071370
AA Change: V726A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: V726A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	54	131	6.8e-4	SMART
CA	155	242	8.81e-21	SMART
CA	266	350	8.27e-26	SMART
CA	375	468	9.14e-28	SMART
CA	492	579	8.4e-27	SMART
CA	608	687	2.53e-12	SMART
low complexity region	703	725	N/A	INTRINSIC
low complexity region	751	759	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226362

Meta Mutation Damage Score

0.1581

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,561,628		probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cntnap1	A	G	11: 101,182,253	D561G	probably damaging	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Cyp4b1	T	C	4: 115,636,313	T191A	probably benign	Het
Dapk1	A	T	13: 60,761,589	M1339L	probably benign	Het
Dpm3	T	C	3: 89,266,908	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,427,924	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Fam184b	T	C	5: 45,542,343	D577G	probably benign	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hsf2bp	C	T	17: 31,987,348	D270N	probably null	Het
Lactbl1	T	C	4: 136,637,591	V418A	possibly damaging	Het
Lifr	A	T	15: 7,166,898	M188L	probably benign	Het
Ltbp1	G	T	17: 75,312,997	G760V	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,240,946	L312P	possibly damaging	Het
Olfr365	T	A	2: 37,201,562	M107K	probably benign	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr898	T	C	9: 38,349,169	F23L	probably benign	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Phf20l1	T	C	15: 66,615,222	S369P	probably benign	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Proser3	A	G	7: 30,540,671	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,725,410	T646M	probably benign	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snx9	G	A	17: 5,908,626	W292*	probably null	Het
St14	T	C	9: 31,090,458	I784V	probably benign	Het
Strc	A	G	2: 121,380,823	S14P	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ubap1	G	A	4: 41,371,850		probably null	Het
Zfr	T	C	15: 12,118,340		probably null	Het

Other mutations in Pcdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pcdh17	APN	14	84447544	missense	probably damaging	1.00
IGL00902:Pcdh17	APN	14	84446849	missense	probably damaging	1.00
IGL01596:Pcdh17	APN	14	84448192	missense	probably damaging	1.00
IGL01665:Pcdh17	APN	14	84447002	missense	probably damaging	0.99
IGL01944:Pcdh17	APN	14	84447520	missense	probably benign	0.01
IGL01944:Pcdh17	APN	14	84447521	missense	probably damaging	0.98
IGL01977:Pcdh17	APN	14	84533097	missense	possibly damaging	0.49
IGL01988:Pcdh17	APN	14	84446622	missense	probably damaging	1.00
IGL02168:Pcdh17	APN	14	84533195	missense	probably benign	0.19
IGL02500:Pcdh17	APN	14	84533469	missense	probably benign	0.17
IGL02874:Pcdh17	APN	14	84448240	missense	possibly damaging	0.71
IGL02882:Pcdh17	APN	14	84446661	missense	probably damaging	0.98
IGL02941:Pcdh17	APN	14	84448307	missense	probably damaging	1.00
IGL03328:Pcdh17	APN	14	84533111	missense	probably benign
R0226_Pcdh17_958	UTSW	14	84448201	missense	probably damaging	0.99
R3405_Pcdh17_345	UTSW	14	84446622	missense	probably damaging	1.00
PIT4151001:Pcdh17	UTSW	14	84447358	missense	probably benign	0.05
R0226:Pcdh17	UTSW	14	84448201	missense	probably damaging	0.99
R0537:Pcdh17	UTSW	14	84447457	missense	probably damaging	1.00
R0647:Pcdh17	UTSW	14	84447773	missense	possibly damaging	0.58
R0939:Pcdh17	UTSW	14	84447755	missense	probably damaging	1.00
R1014:Pcdh17	UTSW	14	84447488	missense	probably damaging	1.00
R1753:Pcdh17	UTSW	14	84477654	missense	probably benign	0.17
R3404:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3405:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3406:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3746:Pcdh17	UTSW	14	84533037	missense	probably benign	0.02
R3852:Pcdh17	UTSW	14	84447259	nonsense	probably null
R4015:Pcdh17	UTSW	14	84447107	missense	probably damaging	0.99
R4348:Pcdh17	UTSW	14	84447620	missense	probably damaging	0.97
R4365:Pcdh17	UTSW	14	84448286	missense	probably damaging	0.97
R4693:Pcdh17	UTSW	14	84533520	missense	probably damaging	1.00
R4811:Pcdh17	UTSW	14	84447935	missense	probably damaging	1.00
R5007:Pcdh17	UTSW	14	84533297	missense	probably benign
R5074:Pcdh17	UTSW	14	84533342	missense	probably benign
R5080:Pcdh17	UTSW	14	84533310	missense	probably benign	0.01
R5138:Pcdh17	UTSW	14	84447209	missense	probably damaging	1.00
R5330:Pcdh17	UTSW	14	84533046	missense	probably damaging	1.00
R5541:Pcdh17	UTSW	14	84447416	missense	probably damaging	0.97
R5686:Pcdh17	UTSW	14	84532993	missense	probably damaging	1.00
R5692:Pcdh17	UTSW	14	84448540	missense	probably benign	0.22
R5695:Pcdh17	UTSW	14	84446360	missense	probably damaging	1.00
R5949:Pcdh17	UTSW	14	84447556	missense	probably damaging	1.00
R6127:Pcdh17	UTSW	14	84533060	missense	probably damaging	0.96
R6294:Pcdh17	UTSW	14	84477668	missense	probably benign	0.01
R6508:Pcdh17	UTSW	14	84447979	missense	probably damaging	1.00
R6726:Pcdh17	UTSW	14	84446217	missense	probably damaging	1.00
R7094:Pcdh17	UTSW	14	84447395	missense	probably damaging	1.00
R7137:Pcdh17	UTSW	14	84533549	missense	possibly damaging	0.65
R7828:Pcdh17	UTSW	14	84532985	missense	probably damaging	0.99
R7904:Pcdh17	UTSW	14	84448484	missense	possibly damaging	0.94
R8507:Pcdh17	UTSW	14	84445944	start gained	probably benign
R9069:Pcdh17	UTSW	14	84447644	missense	possibly damaging	0.58
R9239:Pcdh17	UTSW	14	84533209	missense	probably benign	0.45
R9283:Pcdh17	UTSW	14	84448153	missense	possibly damaging	0.78
R9382:Pcdh17	UTSW	14	84448082	missense	probably damaging	1.00
R9402:Pcdh17	UTSW	14	84447206	missense	probably damaging	1.00
R9459:Pcdh17	UTSW	14	84448623	missense	probably benign	0.00
R9548:Pcdh17	UTSW	14	84447962	missense	possibly damaging	0.67
R9560:Pcdh17	UTSW	14	84533458	missense	probably benign	0.00
R9777:Pcdh17	UTSW	14	84446243	missense	probably benign	0.00
R9792:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9793:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9794:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9795:Pcdh17	UTSW	14	84532910	nonsense	probably null
X0025:Pcdh17	UTSW	14	84446562	missense	possibly damaging	0.86
X0026:Pcdh17	UTSW	14	84533097	missense	possibly damaging	0.49
X0027:Pcdh17	UTSW	14	84448310	missense	possibly damaging	0.80
Z1088:Pcdh17	UTSW	14	84448274	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGAAGGTGACCGATCATGGC -3'
(R):5'- CGGGTTTGGTAGTCGAAGTACATAG -3'

Sequencing Primer
(F):5'- TGACCGATCATGGCAAGCC -3'
(R):5'- GGACTGCTCACCACGTTCATG -3'

Posted On

2015-07-06