Incidental Mutation 'R0143:Cyp4b1'
ID22431
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115635874 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 258 (D258N)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably damaging
Transcript: ENSMUST00000102707
AA Change: D258N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: D258N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135569
AA Change: D134N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143237
Predicted Effect unknown
Transcript: ENSMUST00000145841
AA Change: G168S
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: G168S

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Meta Mutation Damage Score 0.4036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0725:Cyp4b1 UTSW 4 115626827 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1084:Cyp4b1 UTSW 4 115640312 missense probably benign 0.00
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2279:Cyp4b1 UTSW 4 115640360 missense probably benign 0.23
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R2885:Cyp4b1 UTSW 4 115635652 missense probably damaging 1.00
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
R7584:Cyp4b1 UTSW 4 115628687 missense probably damaging 0.98
R7699:Cyp4b1 UTSW 4 115641965 missense probably benign 0.06
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCCTGATGACATGATCTGGAC -3'
(R):5'- ATGGCACTGGACACCCTCATGAAG -3'

Sequencing Primer
(F):5'- TGACATGATCTGGACCAAGAGC -3'
(R):5'- TCCAGAGCCTACTCATGGTG -3'
Posted On2013-04-16