Incidental Mutation 'R4381:Dlgap2'
ID325332
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission 041122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4381 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14846502 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 993 (I993V)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: I992V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: I992V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129119
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: I992V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: I992V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: I978V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: I978V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: I993V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: I993V

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Eml5 A G 12: 98,815,955 I1359T possibly damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
Gpr158 T A 2: 21,827,592 W1168R probably damaging Het
Ighv1-62-1 T A 12: 115,386,993 H18L probably benign Het
Il18r1 A G 1: 40,471,790 I12V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mib2 G C 4: 155,657,612 A234G possibly damaging Het
Mtpap T C 18: 4,383,223 F200S probably benign Het
Nacad T A 11: 6,600,204 T996S probably benign Het
Nek9 T A 12: 85,329,858 T250S probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nipbl A G 15: 8,359,206 V310A probably benign Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 T C 14: 31,025,556 V33A probably benign Het
Pcdha4 A G 18: 36,952,875 E37G probably damaging Het
Pdgfc A G 3: 81,209,251 K304R probably damaging Het
Peak1 G T 9: 56,258,427 A739E probably benign Het
Pla2g4c A T 7: 13,346,065 N433Y probably damaging Het
Polrmt A C 10: 79,741,808 L319R possibly damaging Het
Prkaa1 A T 15: 5,176,808 T373S probably benign Het
Qars G A 9: 108,510,183 probably benign Het
Ranbp1 G A 16: 18,247,344 L33F probably damaging Het
Rpgrip1 C T 14: 52,150,449 P1094L possibly damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tstd2 T C 4: 46,119,933 K340E probably benign Het
Vmn2r45 A T 7: 8,471,913 C705* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zdhhc16 A G 19: 41,940,654 Y232C possibly damaging Het
Zfp1 T A 8: 111,670,451 L354Q probably damaging Het
Zyg11a G A 4: 108,201,320 A341V possibly damaging Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTGGATGAATGGGGCTCC -3'
(R):5'- AGATCTCGATGCTGTCTGCC -3'

Sequencing Primer
(F):5'- GCTCCAGGACTCAGTGTATCTG -3'
(R):5'- CCTCTCCGTAGCAGAGTTCTGG -3'
Posted On2015-07-06