Incidental Mutation 'R0242:Dlgap2'
ID59562
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0242 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14727562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 268 (D268G)
Ref Sequence ENSEMBL: ENSMUSP00000123104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: D268G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: D268G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: D268G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: D269G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense not run
Predicted Primers PCR Primer
(F):5'- GACCAGTTTGAGAAACAGCTCCCC -3'
(R):5'- TGGAAGTCTTTAGTGAGAGGTCCCC -3'

Sequencing Primer
(F):5'- GGATGGTTTCCACACACTGC -3'
(R):5'- CTTTAGTGAGAGGTCCCCAAATG -3'
Posted On2013-07-11