Incidental Mutation 'R4614:Brwd1'
ID344982
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96047359 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 540 (L540H)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: L540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: L540H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: L540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: L540H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: L540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: L540H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124370
AA Change: L263H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: L263H

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126629
Predicted Effect probably damaging
Transcript: ENSMUST00000139566
AA Change: L251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121141
Gene: ENSMUSG00000022914
AA Change: L251H

DomainStartEndE-ValueType
WD40 23 64 3.82e1 SMART
WD40 69 108 4.27e-8 SMART
WD40 129 166 8.59e-1 SMART
WD40 169 209 1.47e-6 SMART
WD40 216 256 9.21e0 SMART
low complexity region 372 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: L540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: L540H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Meta Mutation Damage Score 0.6881 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
bromide UTSW 16 96064887 missense probably damaging 1.00
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
Soporific UTSW 16 96033843 nonsense probably null
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 splice site probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
R8120:Brwd1 UTSW 16 96019449 missense probably benign 0.23
R8187:Brwd1 UTSW 16 96002734 missense probably damaging 0.98
R8359:Brwd1 UTSW 16 96016209 missense probably damaging 1.00
R8480:Brwd1 UTSW 16 96047430 missense probably damaging 0.98
R8511:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATCTCTTATCAGTGGTCGGTAGTC -3'
(R):5'- ACACTTAGGCAGGTGGTCATAC -3'

Sequencing Primer
(F):5'- GTACAGATCACAGAATGACAGTTTG -3'
(R):5'- CTTAGGCAGGTGGTCATACACATAG -3'
Posted On2015-09-25