Incidental Mutation 'R4638:Park7'
ID350789
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 150907099 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 45 (Q45*)
Ref Sequence ENSEMBL: ENSMUSP00000120832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect probably null
Transcript: ENSMUST00000030805
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105673
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105674
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105675
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105676
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128075
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134751
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146184
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148626
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
stiffed UTSW 4 150907090 missense possibly damaging 0.82
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R2416:Park7 UTSW 4 150908401 missense probably benign 0.01
R3032:Park7 UTSW 4 150901052 missense probably benign 0.00
R5345:Park7 UTSW 4 150908423 splice site probably benign
R6585:Park7 UTSW 4 150905264 missense probably benign 0.01
R7957:Park7 UTSW 4 150903884 missense probably damaging 1.00
R8155:Park7 UTSW 4 150907090 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCCAAGTCCTTCTCCTAAAGG -3'
(R):5'- GTAGTGGCTCAGCTACAAATTAGG -3'

Sequencing Primer
(F):5'- GGAAGTCTGTTCTAACTGCAGTCAC -3'
(R):5'- GCTCAGCTACAAATTAGGGCTGTC -3'
Posted On2015-10-08