Incidental Mutation 'R4638:Naa16'
ID350806
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene NameN(alpha)-acetyltransferase 16, NatA auxiliary subunit
SynonymsNarg1l, 1300019C06Rik
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location79325269-79390778 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 79340033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486]
Predicted Effect probably null
Transcript: ENSMUST00000022597
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163486
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227775
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAGGTACCAACTGAAAGATTTT -3'
(R):5'- TCAGAAAGCAGAAAATTGTCTTAGAT -3'

Sequencing Primer
(F):5'- GGATGTTAAGCTTAatgtatgt -3'
(R):5'- GCACAGGGAAGTTTTTGC -3'
Posted On2015-10-08