Incidental Mutation 'R4715:Htr1b'
ID353960
Institutional Source Beutler Lab
Gene Symbol Htr1b
Ensembl Gene ENSMUSG00000049511
Gene Name5-hydroxytryptamine (serotonin) receptor 1B
Synonyms5-HT1B receptor, 5-HT<1B> receptor, 5HT1B receptor
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location81628291-81633828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81631510 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 348 (D348G)
Ref Sequence ENSEMBL: ENSMUSP00000139389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051005] [ENSMUST00000183482]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051005
AA Change: D348G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050898
Gene: ENSMUSG00000049511
AA Change: D348G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 6e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181893
Predicted Effect possibly damaging
Transcript: ENSMUST00000183482
AA Change: D348G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139389
Gene: ENSMUSG00000049511
AA Change: D348G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 5.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183781
Meta Mutation Damage Score 0.5855 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an increase in body weight, aggression, drinking behavior, and osteoblast proliferation and bone mass, and show altered spatial learning and operant conditional behavior as well as reduced anxiety-related response and startle reflex, and small testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Htr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Htr1b APN 9 81631636 missense probably damaging 1.00
IGL03144:Htr1b APN 9 81631945 missense probably damaging 0.96
IGL03350:Htr1b APN 9 81632122 missense probably damaging 1.00
R0395:Htr1b UTSW 9 81631651 missense probably benign 0.09
R0697:Htr1b UTSW 9 81631463 missense possibly damaging 0.77
R1569:Htr1b UTSW 9 81632287 missense probably benign 0.01
R3411:Htr1b UTSW 9 81632041 missense probably benign 0.00
R3821:Htr1b UTSW 9 81632434 missense probably benign 0.02
R4359:Htr1b UTSW 9 81632351 missense probably benign 0.12
R4487:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4489:Htr1b UTSW 9 81631539 missense probably benign 0.01
R5502:Htr1b UTSW 9 81631801 missense possibly damaging 0.82
R6393:Htr1b UTSW 9 81631757 missense probably benign 0.11
R6616:Htr1b UTSW 9 81632434 missense probably benign
R6900:Htr1b UTSW 9 81631570 missense probably damaging 1.00
R7038:Htr1b UTSW 9 81632243 missense probably benign
R7850:Htr1b UTSW 9 81632599 utr 5 prime probably null
R8074:Htr1b UTSW 9 81631529 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCTTCCACCCAGTAACAG -3'
(R):5'- TCAAAGTGCGAGTCTCAGACG -3'

Sequencing Primer
(F):5'- GATTTGACCTACCTGTGAAAAGACC -3'
(R):5'- TCAGACGCCCTGCTGGAAAAG -3'
Posted On2015-10-21