Mutagenetix > Incidental Mutation

Incidental Mutation 'R4715:Tiam2'

353987

Institutional Source

Beutler Lab

Gene Symbol

Tiam2

Ensembl Gene

ENSMUSG00000023800

Gene Name

T cell lymphoma invasion and metastasis 2

Synonyms

3000002F19Rik, STEF

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3326573-3531344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3454168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 982 (F982I)

Ref Sequence

ENSEMBL: ENSMUSP00000125842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]

AlphaFold

Q6ZPF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000072156
AA Change: F982I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: F982I

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169838
AA Change: F982I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: F982I

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000227405

Meta Mutation Damage Score

0.4209

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Arap2	G	T	5: 62,749,094	T194K	probably benign	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
Atp1a1	T	C	3: 101,591,806	E159G	possibly damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Clpx	A	C	9: 65,312,114	R231S	possibly damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Siglec1	T	C	2: 131,074,436	D1198G	probably damaging	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Ubash3b	T	C	9: 41,016,600	K471E	probably damaging	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Tiam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Tiam2	APN	17	3415028	missense	probably benign	0.21
IGL01320:Tiam2	APN	17	3505745	missense	probably damaging	1.00
IGL01384:Tiam2	APN	17	3427202	missense	probably benign	0.08
IGL01575:Tiam2	APN	17	3454316	missense	probably damaging	1.00
IGL01769:Tiam2	APN	17	3427290	missense	probably damaging	1.00
IGL02395:Tiam2	APN	17	3421481	missense	possibly damaging	0.49
IGL02652:Tiam2	APN	17	3439696	splice site	probably benign
IGL03102:Tiam2	APN	17	3509548	missense	probably damaging	1.00
IGL03222:Tiam2	APN	17	3438708	missense	probably damaging	0.97
Feste_burg	UTSW	17	3414622	frame shift	probably null
R0257:Tiam2	UTSW	17	3450813	missense	possibly damaging	0.49
R0420:Tiam2	UTSW	17	3502918	missense	probably benign	0.01
R0528:Tiam2	UTSW	17	3511071	missense	probably damaging	1.00
R0532:Tiam2	UTSW	17	3421646	missense	probably damaging	1.00
R0551:Tiam2	UTSW	17	3428954	missense	probably damaging	1.00
R0554:Tiam2	UTSW	17	3438681	nonsense	probably null
R0645:Tiam2	UTSW	17	3514698	missense	possibly damaging	0.92
R0726:Tiam2	UTSW	17	3512833	unclassified	probably benign
R1139:Tiam2	UTSW	17	3477267	missense	possibly damaging	0.55
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1529:Tiam2	UTSW	17	3516703	missense	probably benign	0.00
R1671:Tiam2	UTSW	17	3506834	missense	probably damaging	1.00
R1731:Tiam2	UTSW	17	3518423	missense	probably damaging	0.98
R1759:Tiam2	UTSW	17	3516003	missense	probably damaging	0.98
R1850:Tiam2	UTSW	17	3437235	missense	probably damaging	1.00
R1853:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1855:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1931:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1932:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1993:Tiam2	UTSW	17	3415126	nonsense	probably null
R2211:Tiam2	UTSW	17	3414918	nonsense	probably null
R2217:Tiam2	UTSW	17	3415114	missense	probably benign	0.34
R2278:Tiam2	UTSW	17	3427220	missense	probably damaging	0.96
R2407:Tiam2	UTSW	17	3477261	missense	probably benign	0.14
R2516:Tiam2	UTSW	17	3453382	missense	probably damaging	1.00
R2991:Tiam2	UTSW	17	3518250	missense	probably benign
R3086:Tiam2	UTSW	17	3421582	missense	probably damaging	1.00
R3121:Tiam2	UTSW	17	3439702	missense	probably benign	0.01
R3686:Tiam2	UTSW	17	3421684	missense	possibly damaging	0.87
R3740:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3742:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3826:Tiam2	UTSW	17	3507701	splice site	probably benign
R3829:Tiam2	UTSW	17	3507701	splice site	probably benign
R3844:Tiam2	UTSW	17	3421651	missense	probably damaging	0.98
R3970:Tiam2	UTSW	17	3428831	missense	probably damaging	1.00
R4060:Tiam2	UTSW	17	3428980	missense	probably benign	0.00
R4296:Tiam2	UTSW	17	3450845	missense	probably benign
R4357:Tiam2	UTSW	17	3450853	missense	probably damaging	1.00
R4368:Tiam2	UTSW	17	3414683	missense	probably benign	0.01
R4369:Tiam2	UTSW	17	3413967	start gained	probably benign
R4524:Tiam2	UTSW	17	3514711	missense	probably damaging	1.00
R4619:Tiam2	UTSW	17	3518342	missense	probably damaging	1.00
R4723:Tiam2	UTSW	17	3450317	missense	probably benign	0.00
R4979:Tiam2	UTSW	17	3505710	missense	probably damaging	1.00
R5182:Tiam2	UTSW	17	3438721	missense	probably damaging	1.00
R5451:Tiam2	UTSW	17	3428996	missense	probably damaging	1.00
R5728:Tiam2	UTSW	17	3414956	missense	probably damaging	0.99
R5827:Tiam2	UTSW	17	3448489	missense	probably benign	0.00
R5879:Tiam2	UTSW	17	3437265	missense	probably damaging	1.00
R5960:Tiam2	UTSW	17	3438640	missense	probably benign	0.24
R5974:Tiam2	UTSW	17	3414809	missense	possibly damaging	0.51
R6198:Tiam2	UTSW	17	3414121	missense	probably benign	0.06
R6222:Tiam2	UTSW	17	3453338	missense	probably damaging	0.96
R6295:Tiam2	UTSW	17	3509556	missense	probably damaging	1.00
R6355:Tiam2	UTSW	17	3414622	frame shift	probably null
R6356:Tiam2	UTSW	17	3414622	frame shift	probably null
R6454:Tiam2	UTSW	17	3438663	missense	probably benign	0.00
R6497:Tiam2	UTSW	17	3506827	missense	probably damaging	1.00
R6579:Tiam2	UTSW	17	3414622	frame shift	probably null
R6580:Tiam2	UTSW	17	3414622	frame shift	probably null
R6581:Tiam2	UTSW	17	3414622	frame shift	probably null
R6582:Tiam2	UTSW	17	3414622	frame shift	probably null
R6648:Tiam2	UTSW	17	3506873	missense	probably damaging	1.00
R6705:Tiam2	UTSW	17	3518243	missense	probably benign	0.01
R6758:Tiam2	UTSW	17	3518403	missense	probably benign	0.01
R6836:Tiam2	UTSW	17	3414380	missense	probably benign	0.17
R6924:Tiam2	UTSW	17	3507795	missense	probably damaging	1.00
R6977:Tiam2	UTSW	17	3518659	missense	probably damaging	1.00
R7051:Tiam2	UTSW	17	3448483	missense	probably damaging	0.99
R7151:Tiam2	UTSW	17	3448385	missense	probably benign	0.36
R7214:Tiam2	UTSW	17	3518412	missense	possibly damaging	0.85
R7332:Tiam2	UTSW	17	3453369	missense	probably damaging	1.00
R7334:Tiam2	UTSW	17	3503008	missense	possibly damaging	0.92
R7414:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R7660:Tiam2	UTSW	17	3482605	start codon destroyed	probably null	0.66
R7743:Tiam2	UTSW	17	3518156	missense	possibly damaging	0.53
R7755:Tiam2	UTSW	17	3421316	missense	probably benign	0.01
R7805:Tiam2	UTSW	17	3509410	missense	probably damaging	1.00
R7813:Tiam2	UTSW	17	3437247	missense	probably damaging	1.00
R7842:Tiam2	UTSW	17	3518124	missense	possibly damaging	0.82
R7989:Tiam2	UTSW	17	3518249	nonsense	probably null
R8011:Tiam2	UTSW	17	3448396	missense	possibly damaging	0.92
R8221:Tiam2	UTSW	17	3518585	missense	probably damaging	0.99
R8260:Tiam2	UTSW	17	3518319	missense	possibly damaging	0.94
R8292:Tiam2	UTSW	17	3506867	missense	probably benign	0.01
R8406:Tiam2	UTSW	17	3507790	missense	possibly damaging	0.94
R8424:Tiam2	UTSW	17	3516041	missense	probably damaging	1.00
R8424:Tiam2	UTSW	17	3516042	missense	probably damaging	1.00
R8430:Tiam2	UTSW	17	3518262	missense	probably benign	0.05
R8530:Tiam2	UTSW	17	3450812	missense	probably benign	0.03
R8692:Tiam2	UTSW	17	3428807	missense	probably damaging	1.00
R8902:Tiam2	UTSW	17	3477196	missense	probably benign	0.00
R9067:Tiam2	UTSW	17	3511132	missense	probably damaging	1.00
R9080:Tiam2	UTSW	17	3414244	missense	probably benign
R9090:Tiam2	UTSW	17	3414736	missense	probably damaging	1.00
R9211:Tiam2	UTSW	17	3448454	missense	possibly damaging	0.94
R9271:Tiam2	UTSW	17	3414736	missense	probably damaging	1.00
R9347:Tiam2	UTSW	17	3421648	missense	probably benign	0.37
R9353:Tiam2	UTSW	17	3507799	nonsense	probably null
R9407:Tiam2	UTSW	17	3503023	missense	probably damaging	1.00
R9460:Tiam2	UTSW	17	3437310	missense	probably damaging	1.00
R9550:Tiam2	UTSW	17	3509431	missense	probably damaging	1.00
X0027:Tiam2	UTSW	17	3414000	start codon destroyed	probably null	1.00
X0060:Tiam2	UTSW	17	3450354	splice site	probably null
X0065:Tiam2	UTSW	17	3505708	missense	probably damaging	1.00
Z1088:Tiam2	UTSW	17	3415019	missense	probably benign	0.01
Z1176:Tiam2	UTSW	17	3505776	missense	probably null	1.00
Z1177:Tiam2	UTSW	17	3427263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTAAGCCTTGCAGATGCTATG -3'
(R):5'- GATGCGGAACACAGCCTTAC -3'

Sequencing Primer
(F):5'- AAGCCTTGCAGATGCTATGTTTCC -3'
(R):5'- CCACTCGTGGCGGTTTTTCTAAAG -3'

Posted On

2015-10-21