Incidental Mutation 'R4715:Atf2'
ID 353921
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Name activating transcription factor 2
Synonyms D130078H02Rik, mXBP, Creb2, ATF-2, CRE-BP
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock # R4715 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 73816509-73892639 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73823300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 282 (V282F)
Ref Sequence ENSEMBL: ENSMUSP00000107647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000173010]
AlphaFold P16951
Predicted Effect probably damaging
Transcript: ENSMUST00000055833
AA Change: V380F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: V380F

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090802
AA Change: V340F

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104
AA Change: V340F

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100009
AA Change: V380F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: V380F

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112007
AA Change: V340F

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104
AA Change: V340F

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112010
AA Change: V340F

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104
AA Change: V340F

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112016
AA Change: V282F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104
AA Change: V282F

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112017
AA Change: V380F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: V380F

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124737
SMART Domains Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
BRLZ 126 190 3.89e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect probably benign
Transcript: ENSMUST00000173010
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184729
Meta Mutation Damage Score 0.8991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73845503 missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73819078 missense probably damaging 1.00
IGL02112:Atf2 APN 2 73819037 missense probably damaging 1.00
IGL02469:Atf2 APN 2 73846332 missense probably damaging 0.99
IGL02686:Atf2 APN 2 73845500 missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73828668 missense probably benign 0.13
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0480:Atf2 UTSW 2 73819156 splice site probably benign
R0732:Atf2 UTSW 2 73845500 missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73845537 missense probably damaging 0.96
R1285:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1287:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1523:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R1622:Atf2 UTSW 2 73853789 splice site probably null
R1731:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1935:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1939:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1965:Atf2 UTSW 2 73850898 missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73863240 critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R2256:Atf2 UTSW 2 73845511 splice site probably null
R3147:Atf2 UTSW 2 73850939 splice site probably null
R3890:Atf2 UTSW 2 73863213 missense probably damaging 1.00
R4680:Atf2 UTSW 2 73828681 splice site probably null
R5161:Atf2 UTSW 2 73829790 critical splice donor site probably null
R5853:Atf2 UTSW 2 73828469 splice site probably null
R7419:Atf2 UTSW 2 73842433 missense probably benign 0.01
R7833:Atf2 UTSW 2 73853885 missense possibly damaging 0.94
R9202:Atf2 UTSW 2 73819128 missense probably damaging 0.99
R9266:Atf2 UTSW 2 73818927 missense probably benign 0.27
X0033:Atf2 UTSW 2 73846281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTACTGGTAGCTCAGCTCACTC -3'
(R):5'- AGGCTACCCAGTTATGGTATTC -3'

Sequencing Primer
(F):5'- TAGCTCAGCTCACTCTGGCAG -3'
(R):5'- GGCTACCCAGTTATGGTATTCATATG -3'
Posted On 2015-10-21