Incidental Mutation 'R4723:Cmtm1'
ID 354608
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene Name CKLF-like MARVEL transmembrane domain containing 1
Synonyms CKLFH1, CHLFH1a, Cklfsf1
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105020174-105036777 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105020307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 371 (A371T)
Ref Sequence ENSEMBL: ENSMUSP00000124800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034344] [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175] [ENSMUST00000212492] [ENSMUST00000212487]
AlphaFold B7ZP21
Predicted Effect probably benign
Transcript: ENSMUST00000034344
SMART Domains Protein: ENSMUSP00000034344
Gene: ENSMUSG00000074127

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159039
AA Change: A283T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430
AA Change: A283T

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160365
AA Change: A182T

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124414
Gene: ENSMUSG00000031876
AA Change: A182T

DomainStartEndE-ValueType
transmembrane domain 89 111 N/A INTRINSIC
transmembrane domain 126 145 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160596
AA Change: A371T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430
AA Change: A371T

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162616
AA Change: A371T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876
AA Change: A371T

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000212492
Predicted Effect probably benign
Transcript: ENSMUST00000212487
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 105,035,927 (GRCm39) missense possibly damaging 0.90
G1citation:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R2900:Cmtm1 UTSW 8 105,036,176 (GRCm39) missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R4615:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5277:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5347:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5364:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5394:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5403:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5611:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5715:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5731:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R5773:Cmtm1 UTSW 8 105,031,808 (GRCm39) missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 105,037,583 (GRCm39) unclassified probably benign
R6207:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R6313:Cmtm1 UTSW 8 105,031,795 (GRCm39) missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 105,035,927 (GRCm39) missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R6821:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R6822:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R7028:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R7128:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R7132:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R7816:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R7819:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R7841:Cmtm1 UTSW 8 105,036,108 (GRCm39) missense possibly damaging 0.55
R7963:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R7988:Cmtm1 UTSW 8 105,036,774 (GRCm39) unclassified probably benign
R8130:Cmtm1 UTSW 8 105,036,088 (GRCm39) missense unknown
R8152:Cmtm1 UTSW 8 105,036,573 (GRCm39) missense possibly damaging 0.83
R8439:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R8459:Cmtm1 UTSW 8 105,036,143 (GRCm39) missense possibly damaging 0.95
R8683:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
R8843:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R8860:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R8871:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R9093:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R9098:Cmtm1 UTSW 8 105,036,334 (GRCm39) frame shift probably null
R9528:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
RF041:Cmtm1 UTSW 8 105,036,102 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCCGTGCCTTTAAGGTCAC -3'
(R):5'- AAAGAGAAACCTGGCCTACTG -3'

Sequencing Primer
(F):5'- TTAAGGTCACACTCACGTACGTGG -3'
(R):5'- CAGGGCCTTTGCAACTCCTG -3'
Posted On 2015-10-21