Incidental Mutation 'R4723:Smchd1'
ID354636
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission 041959-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R4723 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71436747 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 474 (C474*)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably null
Transcript: ENSMUST00000127430
AA Change: C474*
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: C474*

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Arid1b A C 17: 5,337,290 I1673L probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Myo1d A G 11: 80,779,841 probably benign Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr519 A T 7: 108,893,821 F195L probably benign Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Pde2a C G 7: 101,494,618 P148R possibly damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Txlnb A G 10: 17,799,267 H56R probably benign Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTCTGTGTCTCTGCACC -3'
(R):5'- TCAGTGTGCCCTTACAGAAATTG -3'

Sequencing Primer
(F):5'- CTGTGTCTCTGCACCTGTGTG -3'
(R):5'- TGCCCTTACAGAAATTGATGTTAAAG -3'
Posted On2015-10-21