Incidental Mutation 'R4708:Lrrc66'
ID355402
Institutional Source Beutler Lab
Gene Symbol Lrrc66
Ensembl Gene ENSMUSG00000067206
Gene Nameleucine rich repeat containing 66
SynonymsMGC:38937
MMRRC Submission 042017-MU
Accession Numbers

Genbank: NM_153568; MGI: 2387634

Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73606642-73632526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73629662 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 115 (H115R)
Ref Sequence ENSEMBL: ENSMUSP00000084423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170] [ENSMUST00000087177] [ENSMUST00000152215]
Predicted Effect probably benign
Transcript: ENSMUST00000081170
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087177
AA Change: H115R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206
AA Change: H115R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152215
SMART Domains Protein: ENSMUSP00000120280
Gene: ENSMUSG00000067206

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Lrrc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Lrrc66 APN 5 73607114 missense probably benign 0.10
IGL00913:Lrrc66 APN 5 73608156 missense possibly damaging 0.76
IGL00954:Lrrc66 APN 5 73608398 missense possibly damaging 0.94
IGL01061:Lrrc66 APN 5 73615499 missense probably benign 0.01
IGL01343:Lrrc66 APN 5 73608463 missense probably damaging 0.98
IGL01714:Lrrc66 APN 5 73629977 missense probably benign 0.10
IGL01822:Lrrc66 APN 5 73629968 missense probably benign 0.17
IGL02005:Lrrc66 APN 5 73608734 missense possibly damaging 0.83
IGL02166:Lrrc66 APN 5 73607291 missense probably damaging 0.99
IGL02380:Lrrc66 APN 5 73629666 missense possibly damaging 0.55
IGL03162:Lrrc66 APN 5 73607382 missense probably benign
BB002:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
BB012:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
D4043:Lrrc66 UTSW 5 73607526 missense probably benign 0.03
R0126:Lrrc66 UTSW 5 73607088 missense probably benign 0.10
R0437:Lrrc66 UTSW 5 73607687 missense probably benign 0.23
R0638:Lrrc66 UTSW 5 73615473 splice site probably benign
R0658:Lrrc66 UTSW 5 73610944 missense probably benign 0.40
R0729:Lrrc66 UTSW 5 73608414 missense probably benign
R1603:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1774:Lrrc66 UTSW 5 73610855 missense probably benign 0.16
R1831:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1832:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1902:Lrrc66 UTSW 5 73607622 missense probably damaging 0.99
R2858:Lrrc66 UTSW 5 73607303 missense probably benign 0.08
R4097:Lrrc66 UTSW 5 73607704 missense possibly damaging 0.94
R4164:Lrrc66 UTSW 5 73629776 splice site probably null
R4582:Lrrc66 UTSW 5 73608237 missense possibly damaging 0.94
R4856:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R4886:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R5074:Lrrc66 UTSW 5 73608011 missense probably damaging 1.00
R5464:Lrrc66 UTSW 5 73608279 missense probably benign 0.05
R5640:Lrrc66 UTSW 5 73608634 missense probably benign 0.00
R5709:Lrrc66 UTSW 5 73608863 missense probably benign
R5811:Lrrc66 UTSW 5 73615517 missense possibly damaging 0.82
R6146:Lrrc66 UTSW 5 73608089 missense probably benign 0.10
R7037:Lrrc66 UTSW 5 73607161 missense probably benign 0.10
R7041:Lrrc66 UTSW 5 73608556 missense possibly damaging 0.81
R7141:Lrrc66 UTSW 5 73629977 missense probably benign 0.10
R7201:Lrrc66 UTSW 5 73629897 missense probably benign 0.11
R7250:Lrrc66 UTSW 5 73610881 missense probably benign 0.03
R7367:Lrrc66 UTSW 5 73608381 missense probably benign 0.13
R7773:Lrrc66 UTSW 5 73607321 missense probably damaging 0.98
R7925:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
R8057:Lrrc66 UTSW 5 73607532 nonsense probably null
R8167:Lrrc66 UTSW 5 73629609 nonsense probably null
R8552:Lrrc66 UTSW 5 73610885 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCGCTCCCTTGTAACTGAAC -3'
(R):5'- CGTGTCACAGAACACAGACG -3'

Sequencing Primer
(F):5'- TTGTTGACATAAAACACCCGTGC -3'
(R):5'- CAGACGCCATGGATAGAAGTTTCTAC -3'
Posted On2015-10-21