Incidental Mutation 'R0422:Dpep3'
ID37127
Institutional Source Beutler Lab
Gene Symbol Dpep3
Ensembl Gene ENSMUSG00000031898
Gene Namedipeptidase 3
SynonymsMBD-3, 1700018F16Rik
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0422 (G1)
Quality Score125
Status Not validated
Chromosome8
Chromosomal Location105973513-105979429 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105976118 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034371]
Predicted Effect probably null
Transcript: ENSMUST00000034371
SMART Domains Protein: ENSMUSP00000034371
Gene: ENSMUSG00000031898

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peptidase_M19 83 404 1.2e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212917
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound glycoprotein from the family of dipeptidases involved in hydrolytic metabolism of various dipeptides, including penem and carbapenem beta-lactam antibiotics. This gene is located on chromosome 16 in a cluster with another member of this family. Alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Dpep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Dpep3 APN 8 105979147 missense probably benign 0.22
IGL01078:Dpep3 APN 8 105978228 missense probably damaging 1.00
IGL01543:Dpep3 APN 8 105976182 missense probably damaging 1.00
IGL01996:Dpep3 APN 8 105974726 missense probably damaging 1.00
IGL02036:Dpep3 APN 8 105973785 missense probably benign
R0627:Dpep3 UTSW 8 105978731 missense possibly damaging 0.56
R0747:Dpep3 UTSW 8 105977386 missense probably benign 0.12
R1116:Dpep3 UTSW 8 105978829 missense probably damaging 0.98
R1711:Dpep3 UTSW 8 105973693 missense probably benign 0.01
R2085:Dpep3 UTSW 8 105974714 missense probably damaging 1.00
R4385:Dpep3 UTSW 8 105978186 missense probably damaging 1.00
R4860:Dpep3 UTSW 8 105976189 missense probably benign 0.34
R4860:Dpep3 UTSW 8 105976189 missense probably benign 0.34
R5784:Dpep3 UTSW 8 105978743 missense probably benign 0.03
R6658:Dpep3 UTSW 8 105979096 missense probably benign
R6893:Dpep3 UTSW 8 105973842 missense probably benign
R7536:Dpep3 UTSW 8 105977400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTACGGAGCGGAGTTTATCGTC -3'
(R):5'- AGCAAGCACAATGGCAGTCCAG -3'

Sequencing Primer
(F):5'- gccccaagttcaattcccag -3'
(R):5'- CAATGGCAGTCCAGAGGGTC -3'
Posted On2013-05-09