Incidental Mutation 'R4925:Ccdc163'
ID 378937
Institutional Source Beutler Lab
Gene Symbol Ccdc163
Ensembl Gene ENSMUSG00000028689
Gene Name coiled-coil domain containing 163
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 116708509-116751206 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116711331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 77 (E77G)
Ref Sequence ENSEMBL: ENSMUSP00000102070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000106462] [ENSMUST00000106463] [ENSMUST00000106464] [ENSMUST00000125671] [ENSMUST00000130828] [ENSMUST00000135499] [ENSMUST00000138305] [ENSMUST00000155391]
AlphaFold A2AGD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000030452
AA Change: E168G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689
AA Change: E168G

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030453
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106462
AA Change: E77G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102070
Gene: ENSMUSG00000028689
AA Change: E77G

DomainStartEndE-ValueType
coiled coil region 21 53 N/A INTRINSIC
coiled coil region 74 105 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106463
AA Change: E194G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102071
Gene: ENSMUSG00000028689
AA Change: E194G

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106464
AA Change: E194G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102072
Gene: ENSMUSG00000028689
AA Change: E194G

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124628
Predicted Effect probably benign
Transcript: ENSMUST00000125671
SMART Domains Protein: ENSMUSP00000120954
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129624
Predicted Effect probably benign
Transcript: ENSMUST00000130828
SMART Domains Protein: ENSMUSP00000120572
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134192
Predicted Effect probably benign
Transcript: ENSMUST00000135499
SMART Domains Protein: ENSMUSP00000114263
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143330
Predicted Effect probably benign
Transcript: ENSMUST00000156206
SMART Domains Protein: ENSMUSP00000123645
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155391
SMART Domains Protein: ENSMUSP00000120050
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Ccdc163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ccdc163 APN 4 116710290 splice site probably null
IGL01389:Ccdc163 APN 4 116711306 unclassified probably benign
IGL02862:Ccdc163 APN 4 116712713 splice site probably null
R0780:Ccdc163 UTSW 4 116712407 missense probably benign
R2035:Ccdc163 UTSW 4 116711333 missense probably damaging 1.00
R2870:Ccdc163 UTSW 4 116741861 synonymous silent
R3105:Ccdc163 UTSW 4 116709500 missense probably benign 0.27
R4728:Ccdc163 UTSW 4 116709012 unclassified probably benign
R5749:Ccdc163 UTSW 4 116714112 nonsense probably null
R6529:Ccdc163 UTSW 4 116708924 splice site probably null
R6651:Ccdc163 UTSW 4 116709064 missense possibly damaging 0.87
R8306:Ccdc163 UTSW 4 116710275 missense probably damaging 1.00
R8700:Ccdc163 UTSW 4 116714151 critical splice donor site probably null
R8840:Ccdc163 UTSW 4 116710286 critical splice donor site probably null
R9723:Ccdc163 UTSW 4 116712398 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGTTTGGCCTACTCACTTTG -3'
(R):5'- AGTTCCAAGGGATCTGACACC -3'

Sequencing Primer
(F):5'- ACTCACTTTGTTTCTCTGTGATGTTG -3'
(R):5'- GGGATCTGACACCCTCACACAG -3'
Posted On 2016-04-15