Incidental Mutation 'R4933:Golph3l'
ID 380702
Institutional Source Beutler Lab
Gene Symbol Golph3l
Ensembl Gene ENSMUSG00000046519
Gene Name golgi phosphoprotein 3-like
Synonyms 2010204I15Rik, GPP34R
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 95588934-95619247 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95617423 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 328 (N328K)
Ref Sequence ENSEMBL: ENSMUSP00000134799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060323] [ENSMUST00000098861] [ENSMUST00000177390]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000060323
AA Change: N265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058654
Gene: ENSMUSG00000046519
AA Change: N265K

DomainStartEndE-ValueType
Pfam:GPP34 50 275 8.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074353
SMART Domains Protein: ENSMUSP00000136770
Gene: ENSMUSG00000060438

DomainStartEndE-ValueType
Pfam:S10_plectin 3 98 4.8e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098861
SMART Domains Protein: ENSMUSP00000096460
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 277 5.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176541
Predicted Effect unknown
Transcript: ENSMUST00000176674
AA Change: N283K
SMART Domains Protein: ENSMUSP00000134885
Gene: ENSMUSG00000046519
AA Change: N283K

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 104 288 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176755
SMART Domains Protein: ENSMUSP00000134804
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:GPP34 104 275 7.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177389
AA Change: N264K
Predicted Effect probably benign
Transcript: ENSMUST00000177390
AA Change: N328K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134799
Gene: ENSMUSG00000046519
AA Change: N328K

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 332 8.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177399
AA Change: N165K
SMART Domains Protein: ENSMUSP00000134998
Gene: ENSMUSG00000046519
AA Change: N165K

DomainStartEndE-ValueType
Pfam:GPP34 23 170 5.4e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is localized at the Golgi stack and may have a regulatory role in Golgi trafficking. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Golph3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Golph3l APN 3 95589103 missense possibly damaging 0.96
IGL01299:Golph3l APN 3 95617277 missense possibly damaging 0.71
R0749:Golph3l UTSW 3 95607949 missense probably damaging 1.00
R2021:Golph3l UTSW 3 95617357 missense probably benign 0.01
R2161:Golph3l UTSW 3 95617125 missense probably damaging 1.00
R2359:Golph3l UTSW 3 95591964 splice site probably null
R3015:Golph3l UTSW 3 95591713 intron probably benign
R4828:Golph3l UTSW 3 95591748 missense possibly damaging 0.63
R5088:Golph3l UTSW 3 95617190 missense possibly damaging 0.55
R6132:Golph3l UTSW 3 95591834 missense probably benign 0.30
R6339:Golph3l UTSW 3 95617439 missense probably damaging 1.00
R7595:Golph3l UTSW 3 95609783 missense probably benign 0.09
R8164:Golph3l UTSW 3 95617206 missense probably benign 0.06
R9435:Golph3l UTSW 3 95589058 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATGACCCTCAGCGCATG -3'
(R):5'- GTCTGCTTAGAAGGTCATGGC -3'

Sequencing Primer
(F):5'- CATGGACAGGCGAACACTG -3'
(R):5'- CAGAGAGGCCATGAAGTTTTCCTC -3'
Posted On 2016-04-15