Incidental Mutation 'R4933:Gja8'
ID 380703
Institutional Source Beutler Lab
Gene Symbol Gja8
Ensembl Gene ENSMUSG00000049908
Gene Name gap junction protein, alpha 8
Synonyms Cx50, Cnx50, alpha 8 connexin, connexin 50, Lop10, Aey5
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96913566-96926020 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 96919035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062944] [ENSMUST00000199597]
AlphaFold P28236
Predicted Effect unknown
Transcript: ENSMUST00000062944
AA Change: D437V
SMART Domains Protein: ENSMUSP00000049532
Gene: ENSMUSG00000049908
AA Change: D437V

DomainStartEndE-ValueType
CNX 43 76 1.76e-20 SMART
low complexity region 134 147 N/A INTRINSIC
Connexin_CCC 168 234 2.8e-41 SMART
Pfam:Connexin50 267 333 7.3e-35 PFAM
low complexity region 337 355 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Meta Mutation Damage Score 0.2881 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants exhibit microphthalmia, with small lenses and nuclear or total cataracts. Heterozygotes may be equally or less affected, depending on the particular mutation and the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Gja8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gja8 APN 3 96919242 missense probably benign
IGL02114:Gja8 APN 3 96920025 missense probably benign 0.00
IGL02237:Gja8 APN 3 96919933 missense probably benign 0.00
IGL03204:Gja8 APN 3 96920092 missense probably damaging 1.00
L1 UTSW 3 96920197 missense probably damaging 1.00
R1024:Gja8 UTSW 3 96919424 missense probably benign 0.00
R2215:Gja8 UTSW 3 96919902 missense probably damaging 0.98
R2240:Gja8 UTSW 3 96920302 missense probably benign 0.05
R2510:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2511:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2926:Gja8 UTSW 3 96919153 missense probably benign 0.00
R3725:Gja8 UTSW 3 96919845 missense probably damaging 1.00
R4090:Gja8 UTSW 3 96919152 missense probably benign 0.00
R5010:Gja8 UTSW 3 96919849 missense probably benign 0.24
R5497:Gja8 UTSW 3 96920197 missense probably damaging 1.00
R5532:Gja8 UTSW 3 96920332 missense probably benign 0.39
R6997:Gja8 UTSW 3 96919341 missense probably benign
R7381:Gja8 UTSW 3 96920022 missense probably benign
R7576:Gja8 UTSW 3 96919893 missense probably benign 0.05
R7792:Gja8 UTSW 3 96919776 missense probably damaging 1.00
R7827:Gja8 UTSW 3 96920319 missense possibly damaging 0.52
R8444:Gja8 UTSW 3 96919674 missense probably damaging 1.00
R9016:Gja8 UTSW 3 96920205 missense probably damaging 1.00
R9081:Gja8 UTSW 3 96919360 missense probably damaging 1.00
R9230:Gja8 UTSW 3 96919348 missense possibly damaging 0.64
Z1177:Gja8 UTSW 3 96920236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAGCGCATACAGGTGG -3'
(R):5'- ACAGTTGCAGTGCCAGACAG -3'

Sequencing Primer
(F):5'- GAGAGGCAGTCCCCTAGTTGTAC -3'
(R):5'- CAGGGAGAGAGTAGAGACCCCTG -3'
Posted On 2016-04-15