Incidental Mutation 'R4952:Wasf1'
ID 382071
Institutional Source Beutler Lab
Gene Symbol Wasf1
Ensembl Gene ENSMUSG00000019831
Gene Name WAS protein family, member 1
Synonyms WAVE-1, Scar, WAVE
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock # R4952 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 40883475-40938570 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 40936190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 325 (P325Q)
Ref Sequence ENSEMBL: ENSMUSP00000101148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]
AlphaFold Q8R5H6
Predicted Effect unknown
Transcript: ENSMUST00000019975
AA Change: P325Q
SMART Domains Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831
AA Change: P325Q

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105509
AA Change: P325Q
SMART Domains Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831
AA Change: P325Q

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Wasf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Wasf1 APN 10 40920297 missense probably damaging 1.00
IGL01978:Wasf1 APN 10 40936201 missense unknown
IGL02265:Wasf1 APN 10 40936441 missense unknown
IGL02565:Wasf1 APN 10 40936132 missense possibly damaging 0.70
IGL02741:Wasf1 APN 10 40930709 missense probably damaging 1.00
IGL03037:Wasf1 APN 10 40930658 missense probably benign 0.42
potatoes UTSW 10 40926620 critical splice donor site probably null
K3955:Wasf1 UTSW 10 40936195 missense unknown
R0652:Wasf1 UTSW 10 40931906 splice site probably null
R1276:Wasf1 UTSW 10 40936526 missense unknown
R1774:Wasf1 UTSW 10 40934479 missense possibly damaging 0.50
R1813:Wasf1 UTSW 10 40926589 missense probably damaging 1.00
R3607:Wasf1 UTSW 10 40936384 missense unknown
R4418:Wasf1 UTSW 10 40936582 missense unknown
R4997:Wasf1 UTSW 10 40934604 missense probably damaging 0.96
R5178:Wasf1 UTSW 10 40937676 missense unknown
R5718:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5789:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5791:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5839:Wasf1 UTSW 10 40936319 missense unknown
R6247:Wasf1 UTSW 10 40937745 missense unknown
R6688:Wasf1 UTSW 10 40926620 critical splice donor site probably null
R6889:Wasf1 UTSW 10 40920369 missense probably damaging 1.00
R6977:Wasf1 UTSW 10 40926585 missense probably damaging 0.97
R7023:Wasf1 UTSW 10 40936475 missense unknown
R7136:Wasf1 UTSW 10 40926591 missense possibly damaging 0.91
R7224:Wasf1 UTSW 10 40926550 missense probably benign 0.17
R8558:Wasf1 UTSW 10 40930652 missense possibly damaging 0.88
R9023:Wasf1 UTSW 10 40934575 missense possibly damaging 0.70
X0025:Wasf1 UTSW 10 40936697 missense unknown
X0067:Wasf1 UTSW 10 40937657 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTCTACAGGAACATGTTAGTGGG -3'
(R):5'- TGCAACTGCGACAGGAGATG -3'

Sequencing Primer
(F):5'- GGTTTATTTTGATGTAGCTACCGC -3'
(R):5'- TGGCACAGTCTCGCATAC -3'
Posted On 2016-04-27