Incidental Mutation 'R4952:Kpna2'
ID 382084
Institutional Source Beutler Lab
Gene Symbol Kpna2
Ensembl Gene ENSMUSG00000018362
Gene Name karyopherin subunit alpha 2
Synonyms 2410044B12Rik, Importin alpha, m-importin, pendulin, m-importin-alpha-P1, Rch1, importin alpha 1
MMRRC Submission 042549-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R4952 (G1)
Quality Score 162
Status Validated
Chromosome 11
Chromosomal Location 106879455-106890351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106882061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 255 (T255M)
Ref Sequence ENSEMBL: ENSMUSP00000018506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018506] [ENSMUST00000106768] [ENSMUST00000124541] [ENSMUST00000140362] [ENSMUST00000144834] [ENSMUST00000145331]
AlphaFold P52293
Predicted Effect probably damaging
Transcript: ENSMUST00000018506
AA Change: T255M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018506
Gene: ENSMUSG00000018362
AA Change: T255M

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106768
SMART Domains Protein: ENSMUSP00000102379
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 79 4.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124541
SMART Domains Protein: ENSMUSP00000114636
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.7e-29 PFAM
Pfam:Arm 108 149 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140362
SMART Domains Protein: ENSMUSP00000118679
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 24 118 9.7e-30 PFAM
Pfam:Arm 127 168 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144834
SMART Domains Protein: ENSMUSP00000121655
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.1e-29 PFAM
Pfam:Arm 108 149 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145331
SMART Domains Protein: ENSMUSP00000122983
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 74 1.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156495
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,887,063 (GRCm39) probably null Het
4933421I07Rik T C 7: 42,097,083 (GRCm39) Y76C possibly damaging Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Ak9 A G 10: 41,296,585 (GRCm39) M1444V probably benign Het
Amfr A G 8: 94,699,787 (GRCm39) probably benign Het
Ankef1 A G 2: 136,392,449 (GRCm39) E546G probably damaging Het
Ankrd24 A G 10: 81,482,982 (GRCm39) M977V probably benign Het
Ap3m1 A T 14: 21,090,134 (GRCm39) S5T probably benign Het
Aqr C A 2: 113,940,418 (GRCm39) D1243Y probably damaging Het
Arhgef2 T C 3: 88,549,769 (GRCm39) L591P probably damaging Het
Arid4a C A 12: 71,070,299 (GRCm39) T70K possibly damaging Het
Asphd1 C T 7: 126,547,857 (GRCm39) A149T probably benign Het
Avpr1a T A 10: 122,285,659 (GRCm39) M317K probably damaging Het
Birc2 T C 9: 7,836,741 (GRCm39) I109V probably damaging Het
Catsperd A G 17: 56,939,303 (GRCm39) Y44C probably damaging Het
Crygb T G 1: 65,121,268 (GRCm39) S20R probably benign Het
Cyp3a25 T C 5: 145,928,334 (GRCm39) N237S probably benign Het
Dkk3 C T 7: 111,717,558 (GRCm39) A304T probably benign Het
Dst T C 1: 34,310,503 (GRCm39) L4101S probably damaging Het
Dysf A G 6: 84,126,968 (GRCm39) N1407S possibly damaging Het
Epb41 A G 4: 131,727,581 (GRCm39) V265A probably damaging Het
Faim2 C T 15: 99,419,109 (GRCm39) E75K possibly damaging Het
Fam237b T A 5: 5,625,387 (GRCm39) F28I probably benign Het
Fbn1 T A 2: 125,159,454 (GRCm39) D2208V probably damaging Het
Fbxo28 A G 1: 182,153,950 (GRCm39) S129P probably damaging Het
Fbxw14 T A 9: 109,105,269 (GRCm39) I299L probably benign Het
Fras1 C T 5: 96,795,357 (GRCm39) A1050V probably benign Het
Fyb1 C A 15: 6,668,292 (GRCm39) T495K probably damaging Het
Ghdc A T 11: 100,659,977 (GRCm39) W257R probably damaging Het
Gm10719 T C 9: 3,018,962 (GRCm39) L69S probably benign Het
Gm12250 G T 11: 58,079,210 (GRCm39) noncoding transcript Het
Gm4846 A T 1: 166,311,503 (GRCm39) F452Y probably damaging Het
Gpbp1 T C 13: 111,577,284 (GRCm39) D202G probably damaging Het
Gpd2 C A 2: 57,197,025 (GRCm39) Y193* probably null Het
Grhl2 G T 15: 37,287,493 (GRCm39) R229L probably benign Het
Gtf2a1 A G 12: 91,542,523 (GRCm39) F59L possibly damaging Het
Heatr1 G T 13: 12,425,480 (GRCm39) W640L probably benign Het
Kalrn A T 16: 34,177,785 (GRCm39) probably null Het
Keap1 T C 9: 21,148,582 (GRCm39) T142A probably damaging Het
Kpna3 A G 14: 61,607,838 (GRCm39) C456R probably damaging Het
Lama1 G A 17: 68,074,561 (GRCm39) probably null Het
Lrrc37 T C 11: 103,505,033 (GRCm39) T2312A possibly damaging Het
Mag C A 7: 30,608,581 (GRCm39) E178* probably null Het
Map3k13 A G 16: 21,729,769 (GRCm39) I467V probably benign Het
Mga A G 2: 119,733,782 (GRCm39) E210G probably damaging Het
Msi2 C T 11: 88,257,610 (GRCm39) probably null Het
Naa16 A T 14: 79,582,525 (GRCm39) D521E probably damaging Het
Nav2 C T 7: 48,954,288 (GRCm39) probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nek5 T C 8: 22,586,815 (GRCm39) K332R probably benign Het
Nek5 T A 8: 22,569,104 (GRCm39) I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Odad1 A C 7: 45,591,615 (GRCm39) E293A probably damaging Het
Or2w1 G A 13: 21,317,514 (GRCm39) V190I probably benign Het
Or5v1b A T 17: 37,841,641 (GRCm39) T258S possibly damaging Het
Or6c204 T A 10: 129,022,466 (GRCm39) T275S probably benign Het
Or8b12b T A 9: 37,684,360 (GRCm39) M135K probably damaging Het
Orai1 T G 5: 123,167,313 (GRCm39) V162G probably damaging Het
P2rx6 T C 16: 17,385,308 (GRCm39) S134P probably damaging Het
Pappa2 G A 1: 158,684,706 (GRCm39) T811I probably null Het
Pcdhga10 T C 18: 37,880,213 (GRCm39) probably benign Het
Pex16 C T 2: 92,209,405 (GRCm39) R241* probably null Het
Plxnb1 T C 9: 108,943,904 (GRCm39) F1969L probably damaging Het
Postn A G 3: 54,297,736 (GRCm39) probably benign Het
Prdm15 A T 16: 97,607,277 (GRCm39) I752N probably damaging Het
Rasgef1c A T 11: 49,870,339 (GRCm39) K468M probably damaging Het
Rbfox1 A G 16: 7,094,952 (GRCm39) S111G probably benign Het
Rbm28 T C 6: 29,138,597 (GRCm39) D405G probably damaging Het
Rell1 A G 5: 64,097,010 (GRCm39) probably benign Het
Rfx3 A G 19: 27,808,072 (GRCm39) S224P probably damaging Het
Scarb2 A T 5: 92,602,636 (GRCm39) I260K probably damaging Het
Septin4 A G 11: 87,458,598 (GRCm39) N324S probably benign Het
Slc15a4 A G 5: 127,680,901 (GRCm39) F72L probably damaging Het
Spg7 C A 8: 123,816,910 (GRCm39) R534S probably damaging Het
Stoml2 T C 4: 43,029,589 (GRCm39) T164A probably benign Het
Syt11 C T 3: 88,669,590 (GRCm39) G101S possibly damaging Het
Traj12 A G 14: 54,444,013 (GRCm39) probably benign Het
Traj7 A T 14: 54,448,981 (GRCm39) probably benign Het
Tysnd1 C T 10: 61,537,855 (GRCm39) T175I possibly damaging Het
Usp48 T G 4: 137,334,004 (GRCm39) Y139* probably null Het
Vmn2r72 A G 7: 85,400,317 (GRCm39) L244P probably benign Het
Wasf1 C A 10: 40,812,186 (GRCm39) P325Q unknown Het
Zc3h18 T A 8: 123,137,639 (GRCm39) probably benign Het
Zfp712 A G 13: 67,188,905 (GRCm39) S541P possibly damaging Het
Other mutations in Kpna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Kpna2 APN 11 106,882,027 (GRCm39) missense probably benign 0.01
IGL02985:Kpna2 APN 11 106,880,163 (GRCm39) missense probably benign 0.11
R0016:Kpna2 UTSW 11 106,881,912 (GRCm39) missense probably benign
R0233:Kpna2 UTSW 11 106,883,457 (GRCm39) missense probably benign 0.03
R0359:Kpna2 UTSW 11 106,882,148 (GRCm39) missense probably damaging 1.00
R1450:Kpna2 UTSW 11 106,888,135 (GRCm39) missense probably benign 0.05
R1750:Kpna2 UTSW 11 106,882,271 (GRCm39) missense probably damaging 0.99
R4751:Kpna2 UTSW 11 106,883,490 (GRCm39) missense possibly damaging 0.85
R4762:Kpna2 UTSW 11 106,881,085 (GRCm39) missense probably benign 0.04
R4911:Kpna2 UTSW 11 106,881,545 (GRCm39) missense probably damaging 1.00
R4976:Kpna2 UTSW 11 106,882,295 (GRCm39) missense probably damaging 1.00
R5283:Kpna2 UTSW 11 106,881,658 (GRCm39) missense probably damaging 1.00
R5564:Kpna2 UTSW 11 106,881,571 (GRCm39) missense probably damaging 1.00
R6870:Kpna2 UTSW 11 106,883,520 (GRCm39) splice site probably null
R7599:Kpna2 UTSW 11 106,889,583 (GRCm39) missense probably null
R7606:Kpna2 UTSW 11 106,882,884 (GRCm39) missense probably damaging 0.99
R7672:Kpna2 UTSW 11 106,879,789 (GRCm39) missense probably benign 0.00
R9063:Kpna2 UTSW 11 106,883,489 (GRCm39) missense probably benign 0.03
R9067:Kpna2 UTSW 11 106,882,039 (GRCm39) missense possibly damaging 0.94
R9221:Kpna2 UTSW 11 106,880,158 (GRCm39) missense probably damaging 1.00
R9352:Kpna2 UTSW 11 106,880,292 (GRCm39) missense probably damaging 0.96
R9668:Kpna2 UTSW 11 106,881,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAATGGGCAGTTCAGTAG -3'
(R):5'- TGCGATTGACCCACTGTTGG -3'

Sequencing Primer
(F):5'- GCTCCTAGAAGCTTCACAAGTTGG -3'
(R):5'- CGATCTGTCTACCTTGGCAGTAAG -3'
Posted On 2016-04-27