Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Wasf1'

202569

Institutional Source

Beutler Lab

Gene Symbol

Wasf1

Ensembl Gene

ENSMUSG00000019831

Gene Name

WAS protein family, member 1

Synonyms

WAVE-1, Scar, WAVE

MMRRC Submission

039841-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.503) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40883475-40938570 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40926589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 80 (V80D)

Ref Sequence

ENSEMBL: ENSMUSP00000101148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]

AlphaFold

Q8R5H6

Predicted Effect

probably damaging
Transcript: ENSMUST00000019975
AA Change: V80D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831
AA Change: V80D

Domain	Start	End	E-Value	Type
PDB:4N78\|D	1	320	N/A	PDB
low complexity region	321	401	N/A	INTRINSIC
low complexity region	423	435	N/A	INTRINSIC
low complexity region	462	482	N/A	INTRINSIC
WH2	497	514	4.32e-5	SMART
low complexity region	544	556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105509
AA Change: V80D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831
AA Change: V80D

Domain	Start	End	E-Value	Type
PDB:4N78\|D	1	320	N/A	PDB
low complexity region	321	401	N/A	INTRINSIC
low complexity region	423	435	N/A	INTRINSIC
low complexity region	462	482	N/A	INTRINSIC
WH2	497	514	4.32e-5	SMART
low complexity region	544	556	N/A	INTRINSIC

Meta Mutation Damage Score

0.3617

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Wasf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Wasf1	APN	10	40920297	missense	probably damaging	1.00
IGL01978:Wasf1	APN	10	40936201	missense	unknown
IGL02265:Wasf1	APN	10	40936441	missense	unknown
IGL02565:Wasf1	APN	10	40936132	missense	possibly damaging	0.70
IGL02741:Wasf1	APN	10	40930709	missense	probably damaging	1.00
IGL03037:Wasf1	APN	10	40930658	missense	probably benign	0.42
potatoes	UTSW	10	40926620	critical splice donor site	probably null
K3955:Wasf1	UTSW	10	40936195	missense	unknown
R0652:Wasf1	UTSW	10	40931906	splice site	probably null
R1276:Wasf1	UTSW	10	40936526	missense	unknown
R1774:Wasf1	UTSW	10	40934479	missense	possibly damaging	0.50
R3607:Wasf1	UTSW	10	40936384	missense	unknown
R4418:Wasf1	UTSW	10	40936582	missense	unknown
R4952:Wasf1	UTSW	10	40936190	missense	unknown
R4997:Wasf1	UTSW	10	40934604	missense	probably damaging	0.96
R5178:Wasf1	UTSW	10	40937676	missense	unknown
R5718:Wasf1	UTSW	10	40926574	missense	probably damaging	1.00
R5789:Wasf1	UTSW	10	40926574	missense	probably damaging	1.00
R5791:Wasf1	UTSW	10	40926574	missense	probably damaging	1.00
R5839:Wasf1	UTSW	10	40936319	missense	unknown
R6247:Wasf1	UTSW	10	40937745	missense	unknown
R6688:Wasf1	UTSW	10	40926620	critical splice donor site	probably null
R6889:Wasf1	UTSW	10	40920369	missense	probably damaging	1.00
R6977:Wasf1	UTSW	10	40926585	missense	probably damaging	0.97
R7023:Wasf1	UTSW	10	40936475	missense	unknown
R7136:Wasf1	UTSW	10	40926591	missense	possibly damaging	0.91
R7224:Wasf1	UTSW	10	40926550	missense	probably benign	0.17
R8558:Wasf1	UTSW	10	40930652	missense	possibly damaging	0.88
R9023:Wasf1	UTSW	10	40934575	missense	possibly damaging	0.70
R9731:Wasf1	UTSW	10	40930735	missense	probably damaging	1.00
R9800:Wasf1	UTSW	10	40936697	missense	unknown
X0025:Wasf1	UTSW	10	40936697	missense	unknown
X0067:Wasf1	UTSW	10	40937657	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTCACCAAGGCAGGGTTTAC -3'
(R):5'- GGCTGAGCACTCTTACAGATAATAC -3'

Sequencing Primer
(F):5'- CAGGGTTTACGGTCACTGCTC -3'
(R):5'- ACATAGATTTATTTCTGCACAGACAC -3'

Posted On

2014-06-23