Incidental Mutation 'R4942:Olfr10'
ID383215
Institutional Source Beutler Lab
Gene Symbol Olfr10
Ensembl Gene ENSMUSG00000100923
Gene Nameolfactory receptor 10
SynonymsMOR256-55, L45, GA_x6K02T2QP88-6117098-6116163
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4942 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49304741-49320021 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 49317548 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000139744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187570] [ENSMUST00000187570] [ENSMUST00000217290]
Predicted Effect probably null
Transcript: ENSMUST00000187570
AA Change: M1L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187570
AA Change: M1L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217290
AA Change: M1L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Olfr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Olfr10 APN 11 49318300 nonsense probably null 0.00
IGL02283:Olfr10 APN 11 49318335 missense probably benign
IGL03010:Olfr10 APN 11 49318146 missense probably damaging 0.99
R0575:Olfr10 UTSW 11 49318053 missense probably damaging 1.00
R1430:Olfr10 UTSW 11 49318101 unclassified probably null
R1891:Olfr10 UTSW 11 49317857 missense probably benign 0.00
R2509:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R2511:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R5080:Olfr10 UTSW 11 49318087 missense probably benign 0.03
R5413:Olfr10 UTSW 11 49318413 missense probably damaging 1.00
R5843:Olfr10 UTSW 11 49318249 missense probably benign 0.34
R6354:Olfr10 UTSW 11 49317638 missense probably damaging 0.98
R6605:Olfr10 UTSW 11 49317714 missense probably damaging 0.97
R8005:Olfr10 UTSW 11 49318141 missense probably benign 0.12
R8284:Olfr10 UTSW 11 49318175 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCGTAATTCCTAATCCAGGG -3'
(R):5'- TCCTGTCTTGTCCATGGAGG -3'

Sequencing Primer
(F):5'- TCCAGGGTCAATCATTCCATAG -3'
(R):5'- TCCATGGAGGTTGATGAGGAGC -3'
Posted On2016-04-27