Mutagenetix > Incidental Mutation

Incidental Mutation 'R4942:Col9a2'

383174

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121053119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 487 (V487A)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030372
AA Change: V487A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: V487A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,903,258	R420G	probably benign	Het
5730522E02Rik	A	G	11: 25,770,472		probably null	Het
Adamts7	T	C	9: 90,163,311	S23P	probably benign	Het
Adamtsl1	T	A	4: 86,341,214	C824*	probably null	Het
Adgre1	A	G	17: 57,406,903	Y196C	probably damaging	Het
Arap1	A	G	7: 101,401,802	D542G	possibly damaging	Het
B3gat1	A	G	9: 26,755,598	D42G	probably benign	Het
Birc6	G	A	17: 74,623,050	A2412T	probably damaging	Het
Bsn	A	G	9: 108,106,479	Y3459H	unknown	Het
Cacnb1	T	C	11: 98,002,983	Y571C	probably damaging	Het
Cdk2ap2	G	A	19: 4,097,508		probably null	Het
Cep57	A	G	9: 13,813,427	S265P	probably damaging	Het
Clca1	A	G	3: 145,004,763	I893T	probably benign	Het
Clca3a2	T	A	3: 144,806,502	E491V	probably damaging	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cobl	A	T	11: 12,254,185	I832N	probably damaging	Het
Cse1l	C	T	2: 166,929,794	T325I	probably damaging	Het
Dlx6	A	G	6: 6,863,468	Q30R	probably benign	Het
Dnah8	T	C	17: 30,729,142	V1902A	probably benign	Het
Dusp8	A	G	7: 142,082,228	F542L	possibly damaging	Het
Emid1	T	G	11: 5,129,430	M323L	probably benign	Het
Ercc5	A	G	1: 44,175,965	D886G	probably benign	Het
Fam184b	T	C	5: 45,573,307	E461G	probably damaging	Het
Fbn1	C	A	2: 125,383,616	C572F	possibly damaging	Het
Gigyf1	G	T	5: 137,525,690	V1041L	possibly damaging	Het
Grin3b	A	G	10: 79,975,722	H714R	probably damaging	Het
Heatr1	A	G	13: 12,413,510		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lypd6b	C	A	2: 49,946,120	H104Q	probably benign	Het
Man1a	A	T	10: 53,933,490		probably null	Het
Megf6	A	T	4: 154,253,820	D449V	probably damaging	Het
Mtor	T	C	4: 148,472,142	V1003A	probably benign	Het
Ncan	C	A	8: 70,100,294	W1096L	probably damaging	Het
Ndor1	C	T	2: 25,248,121		probably null	Het
Ndufaf1	T	C	2: 119,660,066	E171G	possibly damaging	Het
Nell1	T	C	7: 50,120,649	V152A	possibly damaging	Het
Nt5dc1	A	T	10: 34,322,677	V255E	probably damaging	Het
Olfr10	A	T	11: 49,317,548	M1L	probably null	Het
Olfr434	T	A	6: 43,216,994	F27Y	probably damaging	Het
Olfr619	G	A	7: 103,604,194	R180H	probably benign	Het
Olfr652	A	G	7: 104,565,005	I261M	probably benign	Het
Otud7a	T	C	7: 63,757,423	I50T	probably damaging	Het
P2ry13	G	A	3: 59,209,562	T265I	probably benign	Het
Pde4d	A	G	13: 108,860,199	S12G	probably benign	Het
Pdzd3	C	A	9: 44,248,618	G402*	probably null	Het
Pigk	C	A	3: 152,744,517	N219K	probably damaging	Het
Plcg1	T	A	2: 160,753,589		probably null	Het
Psd2	A	T	18: 35,978,664	D114V	probably damaging	Het
Ptch1	A	T	13: 63,525,070	I770N	probably benign	Het
Ptprq	A	T	10: 107,688,429	M481K	probably benign	Het
Rnf216	A	C	5: 143,093,059	M45R	probably damaging	Het
Rpsa	T	A	9: 120,131,063	W231R	probably benign	Het
Ryr1	G	T	7: 29,069,573	T2797N	probably damaging	Het
Ryr3	A	T	2: 112,836,257	M1468K	probably damaging	Het
Slc6a7	A	G	18: 61,004,517	Y244H	probably damaging	Het
Slco6c1	T	A	1: 97,081,324	D462V	probably damaging	Het
Spata31d1b	A	T	13: 59,717,103	E688D	possibly damaging	Het
Srpr	G	A	9: 35,215,470	R508H	probably benign	Het
Tnrc18	A	T	5: 142,787,982	I181N	unknown	Het
Tnrc6a	T	C	7: 123,192,613	F1785L	probably damaging	Het
Trio	A	T	15: 27,752,725	D2174E	probably benign	Het
Ttn	C	T	2: 76,793,256	V15326I	probably damaging	Het
Ubap2	T	A	4: 41,245,461		probably benign	Het
Vmn2r113	C	T	17: 22,958,347	P702S	probably damaging	Het
Vmn2r66	A	T	7: 85,007,772	W142R	probably damaging	Het
Vmn2r73	A	G	7: 85,870,374	Y459H	probably damaging	Het
Wsb2	C	T	5: 117,377,485	T385M	probably damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGGACAGGTGAGCTCTTC -3'
(R):5'- AGGCCAATCTCTGAGAAGCC -3'

Sequencing Primer
(F):5'- TCCCTCGCTCCGAAAAGG -3'
(R):5'- TGAGAAGCCAAGACACCTCTGG -3'

Posted On

2016-04-27