Mutagenetix > Incidental Mutations

Incidental Mutation 'R4942:Mtor'

383175

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148472142 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1003 (V1003A)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: V1003A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V1003A

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,903,258	R420G	probably benign	Het
5730522E02Rik	A	G	11: 25,770,472		probably null	Het
Adamts7	T	C	9: 90,163,311	S23P	probably benign	Het
Adamtsl1	T	A	4: 86,341,214	C824*	probably null	Het
Adgre1	A	G	17: 57,406,903	Y196C	probably damaging	Het
Arap1	A	G	7: 101,401,802	D542G	possibly damaging	Het
B3gat1	A	G	9: 26,755,598	D42G	probably benign	Het
Birc6	G	A	17: 74,623,050	A2412T	probably damaging	Het
Bsn	A	G	9: 108,106,479	Y3459H	unknown	Het
Cacnb1	T	C	11: 98,002,983	Y571C	probably damaging	Het
Cdk2ap2	G	A	19: 4,097,508		probably null	Het
Cep57	A	G	9: 13,813,427	S265P	probably damaging	Het
Clca1	A	G	3: 145,004,763	I893T	probably benign	Het
Clca3a2	T	A	3: 144,806,502	E491V	probably damaging	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cobl	A	T	11: 12,254,185	I832N	probably damaging	Het
Col9a2	T	C	4: 121,053,119	V487A	possibly damaging	Het
Cse1l	C	T	2: 166,929,794	T325I	probably damaging	Het
Dlx6	A	G	6: 6,863,468	Q30R	probably benign	Het
Dnah8	T	C	17: 30,729,142	V1902A	probably benign	Het
Dusp8	A	G	7: 142,082,228	F542L	possibly damaging	Het
Emid1	T	G	11: 5,129,430	M323L	probably benign	Het
Ercc5	A	G	1: 44,175,965	D886G	probably benign	Het
Fam184b	T	C	5: 45,573,307	E461G	probably damaging	Het
Fbn1	C	A	2: 125,383,616	C572F	possibly damaging	Het
Gigyf1	G	T	5: 137,525,690	V1041L	possibly damaging	Het
Grin3b	A	G	10: 79,975,722	H714R	probably damaging	Het
Heatr1	A	G	13: 12,413,510		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lypd6b	C	A	2: 49,946,120	H104Q	probably benign	Het
Man1a	A	T	10: 53,933,490		probably null	Het
Megf6	A	T	4: 154,253,820	D449V	probably damaging	Het
Ncan	C	A	8: 70,100,294	W1096L	probably damaging	Het
Ndor1	C	T	2: 25,248,121		probably null	Het
Ndufaf1	T	C	2: 119,660,066	E171G	possibly damaging	Het
Nell1	T	C	7: 50,120,649	V152A	possibly damaging	Het
Nt5dc1	A	T	10: 34,322,677	V255E	probably damaging	Het
Olfr10	A	T	11: 49,317,548	M1L	probably null	Het
Olfr434	T	A	6: 43,216,994	F27Y	probably damaging	Het
Olfr619	G	A	7: 103,604,194	R180H	probably benign	Het
Olfr652	A	G	7: 104,565,005	I261M	probably benign	Het
Otud7a	T	C	7: 63,757,423	I50T	probably damaging	Het
P2ry13	G	A	3: 59,209,562	T265I	probably benign	Het
Pde4d	A	G	13: 108,860,199	S12G	probably benign	Het
Pdzd3	C	A	9: 44,248,618	G402*	probably null	Het
Pigk	C	A	3: 152,744,517	N219K	probably damaging	Het
Plcg1	T	A	2: 160,753,589		probably null	Het
Psd2	A	T	18: 35,978,664	D114V	probably damaging	Het
Ptch1	A	T	13: 63,525,070	I770N	probably benign	Het
Ptprq	A	T	10: 107,688,429	M481K	probably benign	Het
Rnf216	A	C	5: 143,093,059	M45R	probably damaging	Het
Rpsa	T	A	9: 120,131,063	W231R	probably benign	Het
Ryr1	G	T	7: 29,069,573	T2797N	probably damaging	Het
Ryr3	A	T	2: 112,836,257	M1468K	probably damaging	Het
Slc6a7	A	G	18: 61,004,517	Y244H	probably damaging	Het
Slco6c1	T	A	1: 97,081,324	D462V	probably damaging	Het
Spata31d1b	A	T	13: 59,717,103	E688D	possibly damaging	Het
Srpr	G	A	9: 35,215,470	R508H	probably benign	Het
Tnrc18	A	T	5: 142,787,982	I181N	unknown	Het
Tnrc6a	T	C	7: 123,192,613	F1785L	probably damaging	Het
Trio	A	T	15: 27,752,725	D2174E	probably benign	Het
Ttn	C	T	2: 76,793,256	V15326I	probably damaging	Het
Ubap2	T	A	4: 41,245,461		probably benign	Het
Vmn2r113	C	T	17: 22,958,347	P702S	probably damaging	Het
Vmn2r66	A	T	7: 85,007,772	W142R	probably damaging	Het
Vmn2r73	A	G	7: 85,870,374	Y459H	probably damaging	Het
Wsb2	C	T	5: 117,377,485	T385M	probably damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	unclassified	probably null
motor	UTSW	4	148491360	missense	possibly damaging	0.76
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148526046	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148539999	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	unclassified	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148538276	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148538547	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7737:Mtor	UTSW	4	148538738	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGCTGGTCAACATGGGAAAC -3'
(R):5'- TGAGAACAATGCTGTCTCTTCC -3'

Sequencing Primer
(F):5'- TGCCCCTGGACGAGTTCTAC -3'
(R):5'- AGAACAATGCTGTCTCTTCCCACTG -3'

Posted On

2016-04-27