Incidental Mutation 'R4979:Zfp871'
ID 384711
Institutional Source Beutler Lab
Gene Symbol Zfp871
Ensembl Gene ENSMUSG00000024298
Gene Name zinc finger protein 871
Synonyms 9030612M13Rik
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4979 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32771236-32788287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32775855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 115 (H115Q)
Ref Sequence ENSEMBL: ENSMUSP00000127178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057501] [ENSMUST00000159086]
AlphaFold G5E905
Predicted Effect possibly damaging
Transcript: ENSMUST00000057501
AA Change: H96Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050501
Gene: ENSMUSG00000024298
AA Change: H96Q

DomainStartEndE-ValueType
KRAB 1 42 1.32e0 SMART
ZnF_C2H2 174 196 5.9e-3 SMART
ZnF_C2H2 202 224 6.32e-3 SMART
ZnF_C2H2 230 252 1.47e-3 SMART
ZnF_C2H2 258 280 3.63e-3 SMART
ZnF_C2H2 286 308 1.79e-2 SMART
ZnF_C2H2 314 336 4.79e-3 SMART
ZnF_C2H2 342 364 1.69e-3 SMART
ZnF_C2H2 370 392 2.79e-4 SMART
ZnF_C2H2 398 420 1.23e-5 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 5.42e-2 SMART
ZnF_C2H2 482 504 8.6e-5 SMART
ZnF_C2H2 510 532 5.21e-4 SMART
ZnF_C2H2 538 560 3.11e-2 SMART
ZnF_C2H2 566 588 2.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159086
AA Change: H115Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127178
Gene: ENSMUSG00000024298
AA Change: H115Q

DomainStartEndE-ValueType
KRAB 4 61 2.18e-15 SMART
ZnF_C2H2 193 215 5.9e-3 SMART
ZnF_C2H2 221 243 6.32e-3 SMART
ZnF_C2H2 249 271 1.47e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 1.79e-2 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.69e-3 SMART
ZnF_C2H2 389 411 2.79e-4 SMART
ZnF_C2H2 417 439 1.23e-5 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 5.42e-2 SMART
ZnF_C2H2 501 523 8.6e-5 SMART
ZnF_C2H2 529 551 5.21e-4 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 2.86e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168337
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Zfp871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp871 APN 17 32775899 missense probably benign
IGL00963:Zfp871 APN 17 32774752 missense probably benign 0.25
IGL01687:Zfp871 APN 17 32775644 missense probably benign 0.00
IGL02170:Zfp871 APN 17 32775688 missense possibly damaging 0.72
IGL02399:Zfp871 APN 17 32774355 missense probably benign 0.18
R0304:Zfp871 UTSW 17 32774434 missense probably damaging 0.99
R1215:Zfp871 UTSW 17 32775972 missense possibly damaging 0.70
R1444:Zfp871 UTSW 17 32774926 missense possibly damaging 0.85
R1754:Zfp871 UTSW 17 32775334 missense probably damaging 1.00
R1913:Zfp871 UTSW 17 32775917 missense possibly damaging 0.53
R2018:Zfp871 UTSW 17 32774777 missense probably damaging 1.00
R2180:Zfp871 UTSW 17 32775301 missense probably damaging 1.00
R2881:Zfp871 UTSW 17 32775433 missense probably damaging 1.00
R4422:Zfp871 UTSW 17 32774833 missense probably benign 0.39
R4422:Zfp871 UTSW 17 32774834 missense probably benign 0.37
R5564:Zfp871 UTSW 17 32775868 missense possibly damaging 0.70
R6228:Zfp871 UTSW 17 32775884 missense possibly damaging 0.50
R6232:Zfp871 UTSW 17 32775520 frame shift probably null
R6233:Zfp871 UTSW 17 32775520 frame shift probably null
R6234:Zfp871 UTSW 17 32775520 frame shift probably null
R6474:Zfp871 UTSW 17 32775673 missense possibly damaging 0.85
R7237:Zfp871 UTSW 17 32775315 missense probably damaging 1.00
R7809:Zfp871 UTSW 17 32774852 missense probably damaging 1.00
R8830:Zfp871 UTSW 17 32774927 missense probably benign 0.03
R9219:Zfp871 UTSW 17 32774940 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCCATATCTATAGTCTTCGTCAC -3'
(R):5'- GCCAACATTTCTGCTGGTAGG -3'

Sequencing Primer
(F):5'- CGTCACAACGCTCAGTTTTATAG -3'
(R):5'- TAGTGATGTACATTTGCTTTCTTCGC -3'
Posted On 2016-05-10