Mutagenetix > Incidental Mutations

Incidental Mutation 'R5028:Map3k19'

391487

Institutional Source

Beutler Lab

Gene Symbol

Map3k19

Ensembl Gene

ENSMUSG00000051590

Gene Name

mitogen-activated protein kinase kinase kinase 19

Synonyms

Ysk4

MMRRC Submission

042619-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5028 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127815253-127855031 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127823232 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 794 (L794Q)

Ref Sequence

ENSEMBL: ENSMUSP00000146463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]

Predicted Effect

probably benign
Transcript: ENSMUST00000061512
AA Change: L590Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: L590Q

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	232	248	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
S_TKc	1044	1307	3.18e-90	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187653
AA Change: L489Q

SMART Domains

Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: L489Q

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	121	137	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
S_TKc	933	1196	1.5e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189398

SMART Domains

Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	216	452	4.8e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191333

SMART Domains

Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	237	500	1.5e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208183
AA Change: L794Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

97% (62/64)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	A	2: 69,274,012	S777C	probably damaging	Het
Ano5	T	A	7: 51,537,710		probably null	Het
Arhgap17	T	A	7: 123,294,673	H508L	probably benign	Het
Arhgap29	T	A	3: 122,010,060		probably null	Het
Atp12a	T	C	14: 56,386,978	F961S	probably damaging	Het
B4galnt4	C	A	7: 141,068,062	P497Q	probably benign	Het
Camsap1	A	G	2: 25,944,556	S364P	probably damaging	Het
Ccdc150	C	A	1: 54,263,477	D85E	probably benign	Het
Cdc45	A	G	16: 18,795,180	Y291H	probably benign	Het
Comp	A	C	8: 70,376,640	N289T	probably damaging	Het
Cops3	T	A	11: 59,818,030		probably benign	Het
Crybg1	G	A	10: 43,998,212	H967Y	possibly damaging	Het
Csmd1	A	T	8: 15,989,090	F2423I	probably damaging	Het
Dact1	C	A	12: 71,318,573	C709*	probably null	Het
Dcxr	T	G	11: 120,726,447	Q90P	probably damaging	Het
Ell	A	G	8: 70,590,699	Y494C	probably damaging	Het
Emilin2	T	C	17: 71,274,732	E333G	possibly damaging	Het
Eml2	T	C	7: 19,179,447		probably null	Het
Fam186b	T	A	15: 99,280,801	M215L	probably damaging	Het
Gm17078	T	A	14: 51,611,242	R13W	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Hspa14	A	G	2: 3,498,169	F196S	possibly damaging	Het
Ier5	A	G	1: 155,099,103	S110P	possibly damaging	Het
Kif1a	T	A	1: 93,054,327	I793F	possibly damaging	Het
Lrrc43	T	C	5: 123,508,113	I643T	probably damaging	Het
Meox2	A	T	12: 37,108,936	M36L	probably benign	Het
Mgat5b	T	A	11: 116,985,029	L693Q	probably damaging	Het
Mup4	T	A	4: 59,958,124	E148V	possibly damaging	Het
Napb	T	C	2: 148,703,137	N162S	possibly damaging	Het
Nlgn2	T	C	11: 69,827,737	D339G	probably benign	Het
Nucks1	C	T	1: 131,928,102	R90C	possibly damaging	Het
Olfr1431	T	A	19: 12,210,154	V196E	possibly damaging	Het
Olfr740	T	C	14: 50,453,739	V229A	probably damaging	Het
Plekhd1	A	T	12: 80,692,949	D24V	probably damaging	Het
Prpf4b	C	T	13: 34,899,975	P909L	probably damaging	Het
Rasgrp1	T	A	2: 117,302,004	K116*	probably null	Het
Ror1	A	G	4: 100,411,936	T324A	possibly damaging	Het
Slc24a4	G	A	12: 102,264,370	G505R	probably damaging	Het
Slc8a1	A	G	17: 81,649,273	I112T	possibly damaging	Het
Smarcc2	A	G	10: 128,461,445	S69G	probably damaging	Het
Smc2	A	T	4: 52,458,447	E429D	probably damaging	Het
Sry	T	C	Y: 2,663,312	D116G	probably damaging	Het
Tcea3	T	A	4: 136,257,935	V154E	possibly damaging	Het
Tigd2	G	A	6: 59,211,220	W357*	probably null	Het
Tmem177	T	A	1: 119,910,689	T87S	probably benign	Het
Treh	A	T	9: 44,682,889	E144V	probably null	Het
Trpm6	T	A	19: 18,786,760	D243E	probably damaging	Het
Ttn	T	C	2: 76,778,050	D17843G	probably damaging	Het
Vars2	A	C	17: 35,659,473		probably null	Het
Vmn1r201	G	A	13: 22,475,360	W248*	probably null	Het
Yap1	T	C	9: 8,001,689	T99A	probably benign	Het
Zbtb8b	C	A	4: 129,433,000	C91F	probably damaging	Het
Zfp882	A	G	8: 71,914,654	T442A	possibly damaging	Het
Zxdc	G	T	6: 90,382,338	G651C	probably benign	Het

Other mutations in Map3k19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Map3k19	APN	1	127824331	nonsense	probably null
IGL01367:Map3k19	APN	1	127824351	missense	possibly damaging	0.88
IGL01443:Map3k19	APN	1	127838507	missense	probably benign	0.38
IGL01481:Map3k19	APN	1	127822478	missense	probably damaging	0.99
IGL01530:Map3k19	APN	1	127822104	missense	probably damaging	1.00
IGL01603:Map3k19	APN	1	127830273	missense	possibly damaging	0.89
IGL02044:Map3k19	APN	1	127823505	missense	probably damaging	1.00
IGL02159:Map3k19	APN	1	127823170	missense	probably benign	0.00
IGL02296:Map3k19	APN	1	127824246	missense	probably damaging	1.00
IGL02349:Map3k19	APN	1	127823769	missense	possibly damaging	0.48
IGL02823:Map3k19	APN	1	127822264	missense	probably benign	0.01
IGL02965:Map3k19	APN	1	127824066	missense	probably damaging	0.98
IGL03137:Map3k19	APN	1	127824315	missense	probably benign	0.04
R0125:Map3k19	UTSW	1	127823100	missense	probably benign	0.07
R0265:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0389:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0443:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0465:Map3k19	UTSW	1	127838527	missense	probably damaging	1.00
R0645:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0759:Map3k19	UTSW	1	127817425	missense	possibly damaging	0.90
R0815:Map3k19	UTSW	1	127834638	splice site	probably benign
R0838:Map3k19	UTSW	1	127823959	missense	probably benign	0.13
R1173:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1174:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1175:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1457:Map3k19	UTSW	1	127817898	missense	probably damaging	1.00
R1661:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1665:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1753:Map3k19	UTSW	1	127822680	missense	probably benign	0.02
R1944:Map3k19	UTSW	1	127823122	missense	probably benign	0.29
R2496:Map3k19	UTSW	1	127823086	missense	probably damaging	1.00
R2878:Map3k19	UTSW	1	127823793	missense	possibly damaging	0.61
R2895:Map3k19	UTSW	1	127822098	missense	possibly damaging	0.60
R3025:Map3k19	UTSW	1	127838553	critical splice acceptor site	probably null
R4577:Map3k19	UTSW	1	127822813	nonsense	probably null
R4612:Map3k19	UTSW	1	127815300	missense	probably benign	0.07
R4888:Map3k19	UTSW	1	127817733	missense	probably damaging	1.00
R4927:Map3k19	UTSW	1	127822195	missense	probably benign	0.08
R5050:Map3k19	UTSW	1	127823562	missense	probably benign	0.21
R5131:Map3k19	UTSW	1	127823690	missense	possibly damaging	0.78
R5556:Map3k19	UTSW	1	127834547	nonsense	probably null
R5606:Map3k19	UTSW	1	127822957	missense	probably benign
R5617:Map3k19	UTSW	1	127822966	missense	probably damaging	1.00
R5755:Map3k19	UTSW	1	127822381	missense	probably benign	0.02
R5854:Map3k19	UTSW	1	127830355	missense	probably damaging	0.96
R5952:Map3k19	UTSW	1	127822740	missense	probably benign	0.01
R6132:Map3k19	UTSW	1	127850476	missense	possibly damaging	0.53
R6175:Map3k19	UTSW	1	127822832	missense	probably benign	0.05
R6261:Map3k19	UTSW	1	127822599	missense	possibly damaging	0.95
R6471:Map3k19	UTSW	1	127817254	missense	probably damaging	1.00
R6726:Map3k19	UTSW	1	127820448	missense	probably benign	0.09
R6732:Map3k19	UTSW	1	127824232	missense	probably benign	0.37
R6762:Map3k19	UTSW	1	127847264	missense	probably damaging	1.00
R7366:Map3k19	UTSW	1	127817455	missense	probably damaging	1.00
R7414:Map3k19	UTSW	1	127838452	missense	probably damaging	0.99
R7686:Map3k19	UTSW	1	127822248	nonsense	probably null
R7702:Map3k19	UTSW	1	127829090	missense	probably damaging	1.00
R7849:Map3k19	UTSW	1	127823646	missense	probably benign	0.21
R8129:Map3k19	UTSW	1	127822683	missense	possibly damaging	0.90
R8134:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8136:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8264:Map3k19	UTSW	1	127823791	missense
R8305:Map3k19	UTSW	1	127817270	missense
R8511:Map3k19	UTSW	1	127847418	missense	possibly damaging	0.71
Z1177:Map3k19	UTSW	1	127822034	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AATGTGACAATAAACAGGGGTTCC -3'
(R):5'- ATTCAAGGACCAAGGCCAGG -3'

Sequencing Primer
(F):5'- CAGGGGTTCCAAACATCTCATAGATG -3'
(R):5'- GGCCAGGAACAGAGCACC -3'

Posted On

2016-06-06