Incidental Mutation 'R3616:Nlrp10'
ID268399
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
MMRRC Submission 040673-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3616 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108924476 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 599 (F599S)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: F599S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: F599S

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Kif1b A T 4: 149,262,283 probably benign Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pard6b T C 2: 168,087,339 probably benign Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
R7397:Nlrp10 UTSW 7 108924692 missense probably damaging 1.00
R7720:Nlrp10 UTSW 7 108924488 missense probably benign 0.36
R7763:Nlrp10 UTSW 7 108925826 missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108925449 missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108925074 missense probably damaging 1.00
R8272:Nlrp10 UTSW 7 108925896 missense probably benign 0.00
Z1177:Nlrp10 UTSW 7 108925851 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACATGCTAAGACTCCTGG -3'
(R):5'- TCATGGGATCTGGAATTCTCTC -3'

Sequencing Primer
(F):5'- AAGTGTCTGTCCTTCCTCATC -3'
(R):5'- ATGGGATCTGGAATTCTCTCTCTATG -3'
Posted On2015-02-19