Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Nlrp10'

268399

Institutional Source

Beutler Lab

Gene Symbol

Nlrp10

Ensembl Gene

ENSMUSG00000049709

Gene Name

NLR family, pyrin domain containing 10

Synonyms

Nalp10, 6430548I20Rik, Pynod

MMRRC Submission

040673-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108921852-108930178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108924476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 599 (F599S)

Ref Sequence

ENSEMBL: ENSMUSP00000050252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055745]

AlphaFold

Q8CCN1

PDB Structure

Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000055745
AA Change: F599S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: F599S

Domain	Start	End	E-Value	Type
PYRIN	9	88	4.13e-18	SMART
low complexity region	126	137	N/A	INTRINSIC
AAA	161	302	1.07e-2	SMART
low complexity region	576	597	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Nlrp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Nlrp10	APN	7	108924581	missense	possibly damaging	0.86
IGL01482:Nlrp10	APN	7	108926952	missense	probably benign
IGL02043:Nlrp10	APN	7	108925502	missense	probably damaging	0.99
IGL03129:Nlrp10	APN	7	108924911	missense	probably damaging	1.00
IGL02835:Nlrp10	UTSW	7	108924662	missense	possibly damaging	0.61
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0540:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R0607:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R1166:Nlrp10	UTSW	7	108925010	missense	probably damaging	1.00
R1248:Nlrp10	UTSW	7	108925881	missense	probably benign	0.08
R1450:Nlrp10	UTSW	7	108925388	missense	probably damaging	0.98
R1459:Nlrp10	UTSW	7	108924348	missense	probably benign
R1567:Nlrp10	UTSW	7	108927050	missense	probably benign	0.02
R1635:Nlrp10	UTSW	7	108924530	missense	possibly damaging	0.93
R1845:Nlrp10	UTSW	7	108927041	missense	probably damaging	1.00
R1912:Nlrp10	UTSW	7	108925395	nonsense	probably null
R1952:Nlrp10	UTSW	7	108924563	missense	probably benign	0.20
R1953:Nlrp10	UTSW	7	108925118	missense	probably benign	0.00
R2079:Nlrp10	UTSW	7	108925628	missense	possibly damaging	0.66
R3615:Nlrp10	UTSW	7	108924476	missense	probably benign
R4207:Nlrp10	UTSW	7	108924341	missense	possibly damaging	0.56
R4786:Nlrp10	UTSW	7	108925238	missense	probably damaging	1.00
R5048:Nlrp10	UTSW	7	108924565	missense	probably benign	0.01
R5568:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R5993:Nlrp10	UTSW	7	108927013	missense	probably benign	0.00
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6170:Nlrp10	UTSW	7	108924464	missense	probably benign	0.00
R6320:Nlrp10	UTSW	7	108925746	missense	possibly damaging	0.82
R6935:Nlrp10	UTSW	7	108926900	missense	probably damaging	0.99
R7024:Nlrp10	UTSW	7	108925198	missense	possibly damaging	0.73
R7081:Nlrp10	UTSW	7	108924648	missense	probably benign	0.02
R7397:Nlrp10	UTSW	7	108924692	missense	probably damaging	1.00
R7720:Nlrp10	UTSW	7	108924488	missense	probably benign	0.36
R7763:Nlrp10	UTSW	7	108925826	missense	probably damaging	0.99
R7776:Nlrp10	UTSW	7	108925449	missense	probably damaging	1.00
R7823:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R7852:Nlrp10	UTSW	7	108925074	missense	probably damaging	1.00
R8272:Nlrp10	UTSW	7	108925896	missense	probably benign	0.00
R9181:Nlrp10	UTSW	7	108924901	missense	probably damaging	0.99
R9712:Nlrp10	UTSW	7	108925528	missense	probably damaging	1.00
Z1177:Nlrp10	UTSW	7	108925851	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACATGCTAAGACTCCTGG -3'
(R):5'- TCATGGGATCTGGAATTCTCTC -3'

Sequencing Primer
(F):5'- AAGTGTCTGTCCTTCCTCATC -3'
(R):5'- ATGGGATCTGGAATTCTCTCTCTATG -3'

Posted On

2015-02-19