Mutagenetix > Incidental Mutations

Incidental Mutation 'R5108:Utp20'

393684

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

MMRRC Submission

042696-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5108 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88768873 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1720 (D1720G)

Ref Sequence

ENSEMBL: ENSMUSP00000004470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]

Predicted Effect

probably benign
Transcript: ENSMUST00000004470
AA Change: D1720G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: D1720G

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218967

Predicted Effect

probably benign
Transcript: ENSMUST00000220188

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,094,208	N94Y	probably damaging	Het
Ak2	A	G	4: 129,002,241	T104A	probably damaging	Het
Alox12b	G	T	11: 69,157,382	A46S	probably benign	Het
Ank1	G	T	8: 23,132,555	V1662F	probably benign	Het
Anxa3	T	C	5: 96,830,414	I219T	possibly damaging	Het
Arhgap40	G	A	2: 158,547,679	V588M	probably damaging	Het
Arhgef38	T	C	3: 133,137,268	T514A	probably benign	Het
Ascl4	C	A	10: 85,928,558	A23E	probably benign	Het
Bcl11b	T	C	12: 107,965,726	T196A	probably benign	Het
C1ra	A	T	6: 124,522,922	Y689F	probably damaging	Het
Ccr3	A	G	9: 124,028,931	N101S	probably benign	Het
Cep70	A	T	9: 99,263,812		probably null	Het
Ces1b	A	G	8: 93,071,913	V215A	probably damaging	Het
Cndp1	A	T	18: 84,632,061	I169N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fbxo2	A	G	4: 148,166,029	Q275R	probably damaging	Het
Fbxo44	T	C	4: 148,158,563	N133S	probably damaging	Het
Fzr1	C	T	10: 81,369,450		probably benign	Het
Gm4778	C	T	3: 94,265,835	S50L	probably damaging	Het
Grn	T	C	11: 102,434,402	S213P	probably benign	Het
Ifi203	A	T	1: 173,924,014	C414S	probably damaging	Het
Igfn1	C	T	1: 135,982,441	R135H	probably benign	Het
Kcnk10	T	C	12: 98,435,301	M358V	probably benign	Het
Kcnn2	A	T	18: 45,592,055	Y471F	probably damaging	Het
Klhl20	A	T	1: 161,099,250	V391E	probably damaging	Het
Krt2	C	T	15: 101,813,286	G440D	possibly damaging	Het
Lpin1	A	T	12: 16,573,715	Y223N	probably benign	Het
Luzp2	G	A	7: 55,265,290	C321Y	probably damaging	Het
Mcm3ap	T	C	10: 76,502,702	V1388A	probably benign	Het
Mdga2	A	T	12: 66,486,741	H223Q	probably benign	Het
Mgat4e	G	T	1: 134,541,223	P361Q	probably benign	Het
Mylk3	A	T	8: 85,359,092	I208N	possibly damaging	Het
Myom2	T	A	8: 15,132,667	V1368E	probably damaging	Het
Mypn	C	T	10: 63,136,294	D656N	probably damaging	Het
Nat10	C	A	2: 103,732,203	R596L	probably damaging	Het
Nek8	T	C	11: 78,172,527	D137G	probably damaging	Het
Neurl1a	A	G	19: 47,257,635	K552E	probably damaging	Het
Npdc1	C	T	2: 25,408,655	H260Y	probably damaging	Het
Nuggc	A	T	14: 65,638,680	I581F	probably damaging	Het
Olfr930	T	A	9: 38,930,855	I228N	probably damaging	Het
P2rx6	T	C	16: 17,562,173	Y54H	probably damaging	Het
Pcmtd2	A	G	2: 181,844,423	E112G	probably damaging	Het
Pcnx4	G	A	12: 72,574,081	V892I	probably benign	Het
Pdss1	T	A	2: 22,906,883	V136E	possibly damaging	Het
Pias3	T	C	3: 96,704,937	L561P	possibly damaging	Het
Pomgnt1	G	A	4: 116,156,256		probably benign	Het
Scn2a	C	T	2: 65,688,630	T400I	probably damaging	Het
Sec24d	T	A	3: 123,305,785		probably null	Het
Sftpb	T	G	6: 72,304,656	L11R	probably damaging	Het
Slc22a19	A	G	19: 7,711,171	I8T	probably benign	Het
Slc22a30	A	G	19: 8,386,426	S266P	probably damaging	Het
Slc36a2	C	A	11: 55,159,388	G465W	probably damaging	Het
Slc4a2	G	A	5: 24,439,333	M976I	probably damaging	Het
Smcr8	C	T	11: 60,779,870	Q615*	probably null	Het
Sobp	T	C	10: 43,160,819	E41G	probably damaging	Het
Spz1	A	T	13: 92,575,046	C307*	probably null	Het
Sult1d1	C	T	5: 87,563,869		probably null	Het
Svs1	C	T	6: 48,988,570	T504I	probably damaging	Het
Tas2r110	T	C	6: 132,868,705	M233T	probably damaging	Het
Tmc3	C	A	7: 83,619,948	S781R	probably damaging	Het
Tmem234	G	T	4: 129,601,937		probably benign	Het
Trpm3	A	T	19: 22,904,714	Q645L	probably benign	Het
Ttn	C	A	2: 76,734,711	V28391F	probably damaging	Het
Txnrd3	G	T	6: 89,673,034	A425S	probably benign	Het
Ubr1	C	T	2: 120,963,422	G94R	probably benign	Het
Ufl1	A	G	4: 25,269,026		probably null	Het
Vmn1r13	T	A	6: 57,209,916	M20K	probably benign	Het
Vmn1r61	A	G	7: 5,610,520	I265T	probably benign	Het
Zfp120	T	C	2: 150,119,942	T29A	probably damaging	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0197:Utp20	UTSW	10	88777516	missense	probably benign	0.22
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2060:Utp20	UTSW	10	88774795	missense	probably damaging	0.98
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3005:Utp20	UTSW	10	88777455	missense	probably damaging	0.97
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3622:Utp20	UTSW	10	88757993	unclassified	probably benign
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4295:Utp20	UTSW	10	88754519	missense	possibly damaging	0.54
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7473:Utp20	UTSW	10	88820710	splice site	probably null
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
R7831:Utp20	UTSW	10	88762770	nonsense	probably null
R7833:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7909:Utp20	UTSW	10	88775330	missense	probably benign
R7956:Utp20	UTSW	10	88782614	missense	probably benign	0.23
R7999:Utp20	UTSW	10	88770388	missense	probably benign
R8080:Utp20	UTSW	10	88782715	missense	possibly damaging	0.82
R8098:Utp20	UTSW	10	88752948	missense	probably benign	0.13
R8104:Utp20	UTSW	10	88757904	missense	probably damaging	1.00
R8129:Utp20	UTSW	10	88792625	missense	probably benign	0.29
R8147:Utp20	UTSW	10	88758444	missense	probably benign	0.02
R8199:Utp20	UTSW	10	88798475	missense	probably benign
R8222:Utp20	UTSW	10	88778372	missense	probably damaging	1.00
R8415:Utp20	UTSW	10	88826604	critical splice donor site	probably null
R8466:Utp20	UTSW	10	88818503	missense	probably damaging	1.00
R8505:Utp20	UTSW	10	88818008	missense	probably benign	0.03
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTATGGCTCCCTGGATGG -3'
(R):5'- AGATGTGGTCTACAGATAGTGCTG -3'

Sequencing Primer
(F):5'- ATGGTTTGAATTGTTCTTTCCAGCTC -3'
(R):5'- GAGAAGGCAGTTGCATGACTTTATC -3'

Posted On

2016-06-15